ПРОТИВОЧУМНАЯ ВАКЦИНА

ПРОТИВОЧУМНАЯ ВАКЦИНА


RU (11) 2197988 (13) C2

(51) 7 A61K39/02, C07K14/24, C12N15/31, C12N15/74 

(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ РОССИЙСКОЙ ФЕДЕРАЦИИ 
Статус: по данным на 18.07.2007 - действует 

--------------------------------------------------------------------------------

(14) Дата публикации: 2003.02.10 
(21) Регистрационный номер заявки: 97116840/13 
(22) Дата подачи заявки: 1996.03.13 
(24) Дата начала отсчета срока действия патента: 1996.03.13 
(31) Номер конвенционной заявки: 9505059.7 
(32) Дата подачи конвенционной заявки: 1995.03.13 
(33) Страна приоритета: GB 
(31) Номер конвенционной заявки: 9524825.8 
(32) Дата подачи конвенционной заявки: 1995.12.05 
(33) Страна приоритета: GB 
(43) Дата публикации заявки: 1999.10.20 
(45) Опубликовано: 2003.02.10 
(56) Аналоги изобретения: WO 9518231 A1, 06.07.1995. RU 2046145 С1, 20.10.1995. LEARY S.E.C. et al. Expression of Yersinia pestis V antigen in attenuated Salmonella typhimurium: Development of a novel vaccine for plauge. Contrib Microbiol. Immuno. - 1995, 13(0) , p.216-217. OYSTON P.C.F. et al. Immunization with live recombinant Salmonella typhimurium aroA producing Fl antigen protects against plauge. Infection and immunity. - 1995, February, vol.63, No 2, p.563-568. 
(71) Имя заявителя: ДЗЕ СЕКРЕТЭРИ ОФ СТЕЙТ ФОР ДЕФЕНС (GB) 
(72) Имя изобретателя: ТИТБОЛЛ Ричард Уилльям (GB); УИЛЛЬЯМСОН Этель Дайэн (GB); ЛИЭРИ Софи Эмма Клэр (GB); ОЙСТОН Петра Клэр Фаркьюхар (GB); БЕННЕТТ Элис Мари (GB) 
(73) Имя патентообладателя: ДЗЕ СЕКРЕТЭРИ ОФ СТЕЙТ ФОР ДЕФЕНС (GB) 
(74) Патентный поверенный: Лебедева Наталья Георгиевна 
(85) Дата соответствия ст.22/39 PCT: 1997.10.13 
(86) Номер и дата международной или региональной заявки: GB 96/00571 (13.03.1996) 
(87) Номер и дата международной или региональной публикации: WO 96/28551 (19.09.1996) 
(98) Адрес для переписки: 129010, Москва, ул. Б. Спасская, 25, стр.3, ООО "Юридическая фирма Городисский и Партнеры", Н.Г. Лебедевой 

(54) ПРОТИВОЧУМНАЯ ВАКЦИНА 

Изобретение относится к вакцине, применяемой для защиты от инфицирования микроорганизмом Yersinia pestis, а также к способу защиты организма человека или животного от инфекции Y. pestis посредством введения такой вакцины. Представленная вакцина содержит иммуногенно эффективное количество V- и F1-антигена, или защитную эпитопную часть каждого из них, или микроорганизм, который экспрессирует V- и F1-антигены по отдельности или вместе и относится к роду, отличному от Yersinia pestis. Вакцина по данному изобретению способна индуцировать защитный иммунный ответ без тяжелых побочных эффектов. 2 с. и 29 з.п. ф-лы, 3 табл., 2 ил. 


ОПИСАНИЕ ИЗОБРЕТЕНИЯ



Изобретение относится к новым вакцинам, применяемым в качестве меры предосторожности по защите от инфицирования микроорганизмом Yersinia pestis, и к способам их введения. В частности, обеспечиваются парентерально или перорально вводимые вакцины, способные обеспечить защиту от бубонной и легочной чумы, особенно путем индукции слизистого иммунитета как у людей, так и у других животных.

Yersinia pestis представляет собой высоко вирулентный патогенный микроорганизм, вызывающий чуму у большого числа животных, включая человека. Инфицирование такими микроорганизмами ведет к высокому коэффициенту смертности. Исследования показали, что высокая вирулентность является следствием сложного ряда факторов, кодируемых как хромосомой, так и тремя плазмидами, включающего в себя гены Lcr, фибринолизин и капсулу.

Человек является случайным хозяином в естественном цикле заболевания, и бубонная чума, характеризующаяся припухлостью местных лимфатических узлов, может развиться вследствие укуса инфицированной блохи. Одним из осложнений бубонной чумы является вторичная пневмония, и в данных случаях заболевание легко передается от человека к человеку воздушнокапельным путем. Чума эндемична для регионов Северной и Южной Америки, Африки, Китая и Азии (смотри Butler (1983) Plaque and Other Yersinia Infections; Plenum Press, New York). Считается, что современные вспышки заболевания являются частью четвертой всемирной пандемии заболевания с очевидной необходимостью защиты лиц, проживающих или передвигающихся по территориям распространения заболевания, и персонала лабораторий, контактирующего с бактерией.

Современные цельноклеточные вакцины, пригодные для предотвращения развития чумы, высоко гетерогенны, что приводит к возникновению побочных эффектов, которые делают их неподходящими для широкомасштабного применения (например, Meyer et аl. (1974) J. Infect.Dis. 129 прил. 13-18 и 85-120; Marshall et al. (1974) там же прил. 19-25).

Одной современной противочумной вакциной является вакцина Cutter, которая содержит зафиксированные формальдегидом бациллы чумы и которую вводят в организм с помощью внутримышечной инъекции. Однако, несмотря на то что парентеральная иммунизация эффективна для индукции системного иммунитета, она не способна эффективно индуцировать слизистый иммунитет (McGhee et al) (1992) Vaccine 10, 75-88), и сообщалось о случаях развития легочной чумы у вакцинированных лиц (Meyer (1970) Bull. WHO 42 стр.653-666). Итак, о вакцине, способной индуцировать защитный иммунный ответ на поверхности слизистых оболочек, не сообщалось.

В бывшем Советском Союзе с 1939 года интенсивно испытывали и применяли живую ослабленную вакцину EV76, хотя ее эффективность в индукции иммунного ответа у человека спорна (Meyer et al. (1974) J.Infect.Dis. 129 прил.: 13-18). Было показано, что вирулентность EV76 различается у нескольких видов животных, и приматы, кроме человека, особенно подвержены хроническому инфицированию данным штаммом. На Западе данную вакцину считают неприменимой для массовых вакцинаций по причине крайней тяжести побочных эффектов и способности штамма возвращаться к полной вирулентности.

Двумя известными антигенами Y.pestis являются LcrV (V-антиген) и F1-антиген Y.pestis, для каждого из которых сейчас обнаружена способность индуцировать защитный иммунный ответ у животных. Авторы настоящего изобретения ранее получили микроорганизмы для живой перорально вводимой вакцины, способные экспрессировать V-антиген и F1-антиген соответственно, каждый из которых обеспечивает хорошую защиту при контрольном заражении Y.pestis до 103 КОЕ. Данные вакцины являются предметом соответствующих заявок на патент PCT/GB 94/02818 и GB 9404577.O.

Авторы настоящего изобретения обнаружили удивительный факт, что тогда как было показано, что только живая вакцина EV, создающая неприемлемо вредные для здоровья факторы, способна обеспечить хорошую защиту при контрольном заражении 109 и более КОЕ штамма GB Y.pestis, a V- и F1-антигены по отдельности обеспечивают полную защиту при контрольном заражении лишь около 105 КОЕ, при введении объединенной вакцины, содержащей V- и F1-антигены, они могут, по меньшей мере, обеспечить такую же защиту, что и EV76, без какого-либо риска, из-за которого воздерживаются от всеобщего применения вакцины EV.

Они обнаружили, что носителем для введения может быть простая смесь двух белковых компонентов, что еще более преимущественно по сравнению с более сложным ослабленным цельным микроорганизмом. Для долгосрочной защиты и в целях индукции слизистого иммунитета они обеспечили предпочтительные формы вакцины, содержащие два компонента в форме живой ослабленной вакцины, такой как F1- и V-экспрессирующая АrоА или С Salmonella typhi, на которую ссылаются в указанных выше совместно поданных заявках, или в более предпочтительных формах одинарного или двойного мутанта, экспрессирующего данные антигены по отдельности, или гибридного белка, содержащего оба антигена.

Далее, обеспечиваются микроорганизмы, содержащие как F1-, так и V-типы construct или плазмид из совместно поданных заявок настоящих заявителей, на которые ссылаются выше. Они включают в себя constructs, которые способны трансформировать микроорганизмы, заселяющие кишечник человека или животного так, чтобы они становились способны экспрессировать белки, которые эквивалентны по последовательности F1- и V-антигенам соответственно; причем это индуцирует защитный иммунный ответ на Yersinia pestis в организме человека или животного, когда микроорганизм вводят перорально или парентерально, и предпочтительно позволяет микроорганизму поддерживать его способность населять кишечник человека или животного.

Особенно предпочтительные рекомбинантная ДНК, плазмида или микроорганизм, заселяющий кишечник человека или животного, кодирует или экспрессирует весь или защитную эпитопную часть зрелого V-белка Yersinia pestis и весь или защитную эпитопную часть зрелого F1-белка Yersinia pestis. ДНК, кодирующая весь или защитную эпитопную часть V-белка, и ДНК, кодирующая весь или защитную эпитопную часть F1-белка, могут применяться непосредственно в качестве генетической вакцины.

Особенно предпочтительная рекомбинантная ДНК, кодирующая V, содержит последовательность ДНК, как описана в ПОСЛ. ИД. 3, более предпочтительно, расположенная в рамке с промотором, таким как lacz и nir, и предпочтительно в векторе способном экспрессировать и реплицироваться в Salmonella. Особенно предпочтительная рекомбинантная ДНК, кодирующая F1, содержит последовательность ДНК, как описана в ПОСЛ. ИД. 10. ПОСЛ. ИД. 2 и ПОСЛ. ИД. 4 показывают аминокислотные последовательности двух предпочтительных V-антигенных белков; ПОСЛ. ИД. 2 представляет собой последовательность самого V-антигена, а ПОСЛ. ИД. 4 представляет собой последовательность V-антигена с четырьмя дополнительными определяемыми вектором N-концевыми аминокислотами. ПОСЛ. ИД. 11 представляет собой последовательность F1-белка, которая кодируется ПОСЛ. ИД. 10.

Предпочтительные constructs ДНК, применяемые в микроорганизмах по изобретению, позволяют получать микроорганизмы, которые будучи введены перорально, индуцируют местную стимуляцию ассоциированной с кишечником лимфоидной ткани (АКЛТ, GALT) и посредством миграции лимфоцитов через общую иммунную систему слизистой оболочки обеспечивают вторичную стимуляцию ассоциированной с бронхами лимфоидной ткани (АБЛТ, BALТ). Таким образом, на поверхности слизистой оболочки дыхательных путей достигается развитие иммунного ответа, опосредованного секреторным IgA.

Микроорганизмы, полученные путем трансформации с применением данной ДНК в виде вектора или вставленной непосредственно, предпочтительно являются ослабленными, более предпочтительно представляют собой ослабленные сальмонеллы.

Ослабленные микроорганизмы, такие как S.typhimurium, били положительно охарактеризованы в качестве носителей для различных гетерологичных антигенов (Curtiss (1990); Cardenas and Clements (1992)). Ослабление может быть осуществлено различными способами, как, например, путем применения подхода, заключающегося в использовании мутаций аrо А и/или аrо С (смотри Hosieth et al. (1980) Nature 291, 238-239; Douqan et al. (1986) Parasite Immunol. 9, 151-160; Chatfield et al. (1989) Vaccine 7, 495-498); также могут быть применены множественные мутации, такие как мутанты аrо А и аrо С, которые описаны Hone et al. (1991) Vaccine 9, стр.810-816. Однако может быть применен любой микрооорганизм с подходящим дефектом, который безопасен для применения в данных целях.

Для данных и других микроорганизмов известные многие другие такие ослабленные делеции и мутации, которые делают их подходящими для трансформации с помощью constructs по настоящему изобретению в целях экспрессии белков вакцины в кишечнике и/или заселения кишечника животных, подлежащих лечению от Y. pestis. Для иммунизации людей векторы, содержащие constructs по настоящему изобретению, помещают в ослабленную S. typhi и данный трансформированный организм применяют в качестве активного ингредиента живой пероральной вакцины.

Когда ДНК применяют для трансформации ослабленного микроорганизма путем непосредственного включения ДНК в микроорганизм, это может быть осуществлено путем непосредственной интеграции в ген. Альтернативно, при включении в форме плазмиды, которая экспрессирует (кодирует?) V- или F1-белок или их эпитопные фрагменты, данная операция может быть осуществлена таким образом, что экспрессируется лишь V- или F1-белок или фрагмент или что экспрессия происходит в виде гибридного пептида с еще одним белковым или пептидным фрагментом, предпочтительно включающим другой из антигенных F1/V-компонентов. Такой еще один белковый или пептидный фрагмент может быть таковым, что это ускорило бы транспорт зрелых белков или пептида через клеточную мембрану наружу, или может представлять собой еще один антиген Y.pestis.

Из штамма KIM Y.pestis Price et al. клонировали ген Icr и опубликовали его нуклеотидную последовательность в J.Bacteriol. (1989) 171, стр.5646-5653. В примерах, приведенных ниже, данную информацию применяли для конструирования олигонуклеотидных праймеров, которые могли бы амплифицировать ген из Y.pestis (штамм GB), применяя полимеразную цепную реакцию (ПЦР). Праймеры ПЦР конструировали так, чтобы они были комплементарны соответствующим последовательностям, располагающимся за 5'- и 3'-концами гена IcrV, при этом имея 5'-концевые хвосты, содержащие сайт узнавания рестриктазы, для того чтобы сделать возможным направленное клонирование амплифицированного гена IcrV в плазмидный вектор (5'-праймер ПЦР, содержащий сайт EcorRI, и 3'-праймер, содержащий сайт Sad). Данные рестриктазные сайты представляют собой лишь примеры и не должны рассматриваться как исключающие другие рестриктазы.

В примерах, приведенных ниже, constructs по изобретению включают в себя lac-промотор, но могут быть применены и другие промоторы, такие как промотор макрофагов (nir).

Продуцирование F1 было в полной мере описано в Oyston et al. (1995) Infect.Immun. Том 63 2 стр.563 - смотри страницу 564 после результатов: Cloning and Expression of cafl.

Дозировка антигенных компонентов в вакцине может варьировать в зависимости от индивидуальных характеристик иммунной системы животных, но для проведения иммунизации на мыши в качестве животной модели в примерах, приведенных ниже, было обнаружено, что по 10 мкг каждого из V и F1 на дозу является эффективной дозировкой для обеспечения полной защиты при использовании стандартного графика первичной и повторной иммунизации.

Антигены могут быть включены в традиционный фармацевтически приемлемый носитель, каких-либо особенных ограничений здесь не налагается. Антигены могут быть с легкостью включены в масло в водной эмульсии. В состав вакцины могут быть включены адъюванты, и было обнаружено, что при лечении мышей в качестве модели эффективным является неполный адъювант Фройнда (НАФ).

Носитель может быть приспособленным для парентерального введения, в частности для внутрибрюшинного введения, но необязательно и для перорального введения, в случае вакцин, основанных на микроорганизмах, или в случае введения в форме капель или капсул, таких как липосомы или микрокапсулы, если это будет эффективно в доставке композиции в дыхательные пути индивидуума в целях индукции иммунного ответа в слизистых оболочках. Носитель может также включать в себя систему замедленного высвобождения, например Alhydrogel.

Другой способ инкапсулирования включает в себя применение полимерных структур, в частности линейных блоксополимеров. Могут быть применены полимеры, подверженные биологическому разложению, например полимолочная кислота с или без гликолевой кислоты или блоксополимер; причем они могут содержать следующее повторяющееся звено: (ПОП-ПОЭ)n, где ПОП представляет собой полиоксипропилен, а ПОЭ представляет собой полиоксиэтилен. Блоксополимеры, которые содержат (ПОП-ПОЭ), особенно применимы.

Теперь с помощью лишь иллюстрации будут приведены примеры способа, constructs, микроорганизмов и вакцин по изобретению путем ссылки на следующие список последовательностей, чертежи и примеры. Остальные осуществления будут очевидны специалистам в данной области в свете данных осуществлений.

Фиг. 1 в форме линейчатой диаграммы иллюстрирует коэффициенты выживаемости в ряде групп после контрольного заражения Y.pestis.

Фиг. 2 в графической форме иллюстрирует первичные ответы, опосредованные IgG, на внутримышечную иммунизацию мышей Balb/c БСА.

Список последовательностей

ПОСЛ. ИД. 1: показывает нуклеотидную и производную аминокислотную последовательности ДНК, кодирующей V, с 6 основаниями вектора pMAL-p2 или pMAL-c2, в котором ее клонируют, используя сайт EcoRI в последовательности GAATTC на 5'-конце (из 5'-концевого праймера ПЦР) и сайт Sall в последовательности GTCGAC на 3'-конце (из 3'-концевого праймера ПЦР). Основание в положении 1006 было заменено путем ПЦР-мутагенеза на Т с получением второго стоп-кодона в рамке. Началом аминокислотной последовательности является С-конец сайта отщепления фактора Ха.

ПОСЛ.ИД. 2: показывает аминокислотную последовательность пептида, экспрессируемого вставочной ДНК по изобретению, с дополнительными четырьмя аминокислотами, кодируемыми вектором (IE+FS) на N-конце.

ПОСЛ. ИД. 3: показывает нуклеотидную и производную аминокислотную последовательности ДНК, кодирующей V, с 10 основаниями вектора pGEX-5X-2, в котором ее клонируют, показанный на 5'-конце, используя сайт EcoRI в последовательности GAATTC (GA - из 5'-концевого праймера ПЦР) и сайт Sall в последовательности GTCGAC (GTCGAC - из 3'-концевого праймера ПЦР). Основание в положении 1006 было заменено путем ПЦР-мутагенеза с получением второго стоп-кодона в рамке; основание в положении 16 было заменено с А на С с получением сайта EcoRI. Началом аминокислотной последовательности является С-конец сайта отщепления фактора Ха.

ПОСЛ. ИД. 4: показывает аминокислотную последовательность пептида, экспрессируемого ДНК с ПОСЛ. ИД. 3, с четырьмя аминокислотами, кодируемыми вектором (G, I, P и G) на N-конце.

ПОСЛ. ИД. 5: показывает нуклеотидную последовательность 5'-концевого затравочного олигонуклеотида, применяемого для создания V-кодирующей ДНК, применяемой в ПОСЛ. ИД. 1.

ПОСЛ. ИД. 6: показывает нуклеотидную последовательность 3'-концевого затравочного олигонуклеотида, применяемого для создания V-кодирующей ДНК, применяемой в примерах.

ПОСЛ. ИД. 7: показывает нуклеотидную последовательность ПЦР-затравочного олигонуклеотида, соответствующего первым 21 основаниям, кодирующим зрелый cafl с дополнительной 5'-областью, кодирующей сайт Saсl.

ПОСЛ. ИД. 8: показывает нуклеотидную последовательность ПЦР-затравочного олигонуклеотида, соответствующего последовательности cafl, которая кодирует "шпильку" правее терминирующего кодона, с дополнительной 5'-областью, кодирующей сайты Sacl и Accl.

ПОСЛ. ИД. 9: показывает нуклеотидную последовательность ПЦР-затравочного олигонуклеотида, соответствующего области внутреннего конца гена cafl, начинающегося на 107 оснований правее конца первого олигонуклеотида.

ПОСЛ. ИД. 10: показывает нуклеотидную последовательность construct pFGAL2a, показывающего слияние нескольких первых оснований последовательности, кодирующей -галактозидазу, в векторе с cafl за исключением его сигнальной последовательности, и имеющего 5'-конец, включающий в себя сайт рестрикции Sac I: последовательность показана до 3'-конца cafl AACC с несколькими основаниями вектора.

ПОСЛ. ИД. 11: показывает аминокислотную последовательность белка, кодируемого pFGAL2a. Данная последовательность может быть продолжена Met, Thr, Met, He, Thr, Asn.

ПОСЛ. ИД. 12: представляет собой последовательность праймера F1OU2, применяемого для амплификации оперона F1.

ПОСЛ. ИД. 13: представляет собой последовательность праймера M4D, применяемого для амплификации оперона F1.

ПОСЛ. ИД. 14: представляет собой последовательность праймера M3U, применяемого для амплификации оперона F1.

ПОСЛ. ИД. 15: представляет собой последовательность праймера FlOD2, применяемого для амплификации оперона F1.

ПОСЛ. ИД. 16: представляет собой нуклеотидную и производную аминокислотную последовательности фрагмента ДНК, кодирующего гибридный белок F1-V. Имеются клонирующий сайт Sacl на 5'-конце и клонирующий сайт Hind III на 3'-конце. Основания 452-472 представляют собой последовательность, содержащуюся в клонируемой вставке, но происходящую из ПЦР-праймеров (не обнаружена в ДНК Y.pestis).

ПОСЛ. ИД. 17: представляет собой аминокислотную последовательность ПОСЛ. ИД. 16.

ПОСЛ. ИД. 18: представляет собой последовательность праймера 5'FAB2, применяемого для амплификации оперона F1, включая сигнальную последовательность.

ПОСЛ. ИД. 19: представляет собой последовательность праймера 3' FBAM, применяемого для амплификации оперона F1, включая сигнальную последовательность.

ПОСЛ. ИД. 20: представляет собой нуклеотидную и аминокислотную последовательности F1-антигена, как определены с помощью ПЦР-праймеров, подробно описанных в приведенной ПОСЛ. ИД. 18 и 19, включая сигнальную последовательность.

ПОСЛ. ИД. 21: представляет собой аминокислотную последовательность ПОСЛ. ИД. 20.

ПОСЛ. ИД. 22: представляет собой нуклеотидную и аминокислотную последовательности гибридного белка F1/V, включая область мостика из 6 аминокислот. G в положении 1522 модифицировали в Т для получения второго стоп-кодона в рамке.

ПОСЛ. ИД. 23: представляет собой аминокислотную последовательность ПОСЛ. ИД. 22. Область мостика, на которую ссылаются в ПОСЛ. ИД. 22, представлена аминокислотами в положениях 171-176 (основания 523-540) в ПОСЛ. ИД. 22.

ПОСЛ. ИД. 24: показывает нуклеотидную последовательность 5'-концевого затравочного олигонуклеотида, применяемого для создания V-кодирующей ДНК, применяемой в ПОСЛ. ИД. 3.

ПРИМЕРЫ

Клонирование ПОСЛ. ИД. 3

Материалы и методы: материалы для приготовления сред для выращивания получали из Oxoid Ltd. или Difco Laboratories. Все ферменты, применявшиеся для манипуляций с ДНК, получали из Boehringer Mannheim UK Ltd. и применяли в соответствии с инструкциями производителя. Все остальные химические и биохимические реактивы получали из Sigma Chemical Co, если только не указывается особо. Моноспецифичные кроличью поликлональную анти-V и мышиную анти-GST сыворотки получали от Dr.R.Brubaker (Department of Microbiology, Michigan State University) Dr. E.D.Willianson. (Chemical and Biological Defence Establishment) соответственно.

Штаммы бактерий и культивирование: Yersinia pestis GB культивировали в аэробных условиях при 28oС в жидкой среде (рН 6,8), содержащей 15 г протеолитического пептона, 2,5 г гидролизата печени, 5 г дрожжевого экстракта, 5 г NaCl на литр с добавлением 80 мл 0,25% гемина, растворенного в 0,1М NaOH (Blood Base Broth). Escherichia coli JM109 культивировали и хранили, как описано Sambrook et al. Molecular Cloning. A Laboratory Manual.

Получение рекомбинантных V- и F1-белков: манипуляции на ДНК. Хромосомную ДНК выделяли из Y.pestis по методу Marmur.

Получение рекомбинантного V-антигена: ген, кодирующий V-антиген (1crV), амплифицировали из ДНК Y.pestis, применяя полимеразную цепную реакцию (ПЦР) с использованием 125 пмоль праймеров, гомологичных последовательностям между 5'- и 3'-концами гена (смотри Price et al. (1989) J.Bacteriol. 171 стр. 5646-5653).

Последовательности 5'-праймера (V/5'E: GATCGAATTCGAGCCTACGAACAA) и 3'-праймера (GGATCGTCGACTTACATAATTACCTCGTGTCA) также включают в себя 5'-области, кодирующие сайты рестрикции EcoRI и Sall соответственно. В дополнение к этому, два нуклеотида были изменены по сравнению с опубликованной последовательностью IcrV (Price et al., 1989) так, что сайт EcoRI был завершен, и амплифицированный ген кодировал дополнительный терминирующий кодон (ТАА). ПЦР-праймеры получали с помощью синтезатора ДНК (392 Applied Biosystems) Applied Biosystems. Фрагмент ДНК получали после 30 циклов амплификации (95oС, 20 с, 45oС, 20 с, 72oС, 30 с: Perkin GeneAmp PCR System). Фрагмент очищали, расщепляли с помощью EcoRI и Sall, лигировали с надлежащим образом расщепленной плазмидой pGEX-5Х-2 и трансформировали E. coli JM109 путем электропорации (смотри Sambrook et al. 1989). Колонию, содержащую рекомбинантную плазмиду (pVGlOO), идентифицировали с помощью ПЦР, применяя 30-mer праймеры (5'-нуклеотиды, расположенные в положениях 54 и 794; смотри Price et al., 1989), которые амплифицируют внутренний сегмент гена IcrV).

Экспрессия rV в E.coli: культуры E.coli. JMlP9/pVGl00 выращивали на LB, содержащем 100 мкгмл-1 ампициллин при 37oС до тех пор, пока поглощение (600 нм) не становилось равным 0,3. Затем к культуре добавляли изопропил---D-тиогалактопиранозид (ИТГП) до конечной концентрации 1 мМ и выращивание продолжали в течение последующих 5 часов. Цельные клеточные лизаты бактерий получали, как описано в Sambrook et al., и экспрессию гибридного белка GST/V исследовали путем окрашивания 10% SDS-полиакриламидных гелей (Mini-Protean II, Bio-Rad) кумасси бриллиантовым голубым R250 и путем вестерн-блоттинга (смотри Sambrook et al.). Отпечатки, полученные с помощью вестерн-блоттинга, метили с помощью кроличьей анти-V сыворотки в разведении 1/4000 или мышиной анти-GST сыворотки в разведении 1/1000 и белковые ансамбли визуализировали с помощью вторичных антител, меченных коллоидным золотом (Auroprobe BLplus, Cambio).

Количественный анализ экспрессии GST/V in vitro. Культуры E.coli JM109, содержащие pVGl00 или pGEX-5X-2, выращивали, как описано выше. Из культур в логарифмической и стационарной фазах отбирали аликвоты по одному мл и количество жизнеспособных клеток определяли путем посева на L-arap, содержащий ампициллин. Клетки из второй 1 мл аликвоты собирали методом центрифугирования и ресуспендировали в 1 мл фосфатно-буферного раствора (ФБР). Суспензию клеток замораживали до -20oС в течение 1 часа, оттаивали и затем обрабатывали ультразвуком на льду при температуре на 10oС ниже в течение 3 х 30 с (генератор ультразвука модели XL2015, зонд Microtip 3,2 мм; Heat Systems Inc.). На планшете для микротитрования делали серии разведений в ФБР гомогенатов, полученных с помощью ультразвука, и стандартного раствора rV (5 мкгмл) и оставляли на ночь при oС для протекания связывания. Количество гибридного белка GST/V в каждом гомогенате, полученном с помощью ультразвука, определяли по стандартной методике ELISA, применяя кроличью анти-V сыворотку в качестве первичного антитела. Антитела инкубировали в 1%-ном растворе порошка обезжиренного молока в ФБР.

Очистка rV. E. coli JM109/pVG100 выращивали в 5100 мл объемах LB, как описано выше. Клетки собирали методом центрифугирования и ресуспендировали в 3 мл фосфатно-буферного раствора (ФБР). После добавления 80 мкл лизоцима (10 мгмл-1) клеточную суспензию инкубировали в течение 10 мин при 22oС. Добавляли Тритон Х-100 до конечной концентрации 1% и клетки замораживали (-20oС), оттаивали и обрабатывали ультразвуком на льду на 70% мощности в течение 330 с (генератор ультразвука модели XL2015). Лизированные клетки центрифугировали и объем супернатанта доводили до 30 мл с помощью ФБР и смешивали с 5 мл глютатион-сефарозы 4В (Pharmacia Biotech), которую трижды промывали ФБР + 0,1% Тритоном Х-100. Смесь перемешивали в течение 18 часов при 4oС, центрифугировали и дважды промывали 100 мл ФБР и затем набивали в хроматографическую колонку (Poly-Prep; BioRad) в виде 50% взвеси. Гибридный белок GST/V элюировали 10 мл 50 мМ Триса, рН 8,0, содержащего 5 мМ восстановленный глютатион (Pharmacia Biotech). После диализа против ФБР гибридный белок расцепляли фактором Ха (Boehringer Mannheim UK Ltd.) в течение 18 часов при 22oС, в соответствии с инструкциями производителя. Отщепленный GST и избыток нерасщепленного GST/V удаляли из раствора путем афинной адсорбции, как описано выше, оставляя очищенный рекомбинантный V (rV).

Иммунизация rV. В данном исследовании применяли самок мышей Bald/c в возрасте шести недель, выращенных в особых условиях, свободных от патогенов (Charles River Laboratories, Margate, Kent, UK). Группа из 16 мышей получала 0,2 мл первичную иммунизирующую дозу 10,13 мкг rV-антигена, презентированного в 1: 1 водомасляной эмульсии с неполным адъювантом Фройнда (НАФ), внутрибрюшинно (в/б). На 14 и 34 дни каждое животное получало повторные иммунизирующие дозы, приготовленные, как описано выше. На 64 день 6 животных забивали и их ткани отбирали для проведения иммунологических анализов, как описано ниже. Оставшихся животных подвергали контрольному заражению Y. pestis. Контрольную группу не подвергавшихся иммунизации 16 мышей одного возраста делили сходным образом на группы для отбирания образцов тканей и контрольного заражения. В последующем эксперименте по определению степени защиты от более высоких доз Y. pestis при контрольном заражении применяли группы из 5 или 6 rV-иммунизированных и контрольных мышей.

Измерение титра сывороточных антител у мышей, анестезированных в/б 0,1 мл смеси, содержащей 6 мг Domitor (Norden Laboratories) и 27 мкг кеталара (Parke-Davies), отбирали образцы крови путем пункции сердца. Образцы группировали и сыворотку отделяли. Титр сывороточных антител измеряли с помощью модифицированного ELISA (Willimson and Tiball, (1993) Vaccine 11: 1253-1258). Вкратце, rV (5 мкгмл-1 в ФБР) наносили на планшет для микротитрования и на планшете в двойном экземпляре готовили серии разведений тестируемых сывороток. Связавшиеся антитела определяли, применяя конъюгаты антимышиных поливалентных Ig, меченных пероксидазой. Титр специфичных антител определяли как максимальное разведение сыворотки, позволяющее получить показатель поглощения больше чем 0,1 единицы, после вычитания поглощения, имеющего место при неспецифическом связывании, определенного в контрольных сыворотках.

Выделение очищенных Т-клеток из селезенки. Сырую суспензию смешанных клеток селезенки получали путем аккуратного протирания селезенки сквозь мелкоячеистое сито. Клетки отмывали от капсулы селезенки и соединительной ткани 2 мл тканевой культуральной среды (DMEM с 20 мМ L-глютамином,105 ME1 пенициллина и 100 мгл-1 стрептомицина. Из суспензии клеток селезенки путем центрифугирования в градиенте плотности Ficoll-Hypaque (Lymphocyte Separation Medium, ICN Flow) выделяли популяцию смешанных лимфоцитов. Для определения процента жизнеспособных клеток в препарате применяли смешанный краситель, содержавший акридиновый оранжевый (0,0003% м/о) и бромид этидия (0,001% м/о).

Смешанные лимфоциты инкубировали с Dynabeads (M450, Dynal UK), покрытыми антимышиным IgG барана, в соотношении 1:3 в течение 30 минут при 4oС. В-клетки, связавшиеся с Dynabead, удаляли методом магнитного разделения и оставшиеся Т-клетки ресуспендировали в DMEM с добавлением антибиотика и 10% по объему околоплодной сыворотки теленка (ОСТ) до желаемой клеточной плотности для засевания планшетов для микротитрования.

Пролиферация неочищенных клеток селезенки и очищенных Т-клеток in vitro в ответ на rV. В лунках планшета для микротитрования делали двухкратные убывающие разведения rV и конканавалина А (положительный контроль) в DMEM (в интервале 0-50 мкгмл-1) так, что в каждой лунке было по 0,1 мл. Отрицательные контроли состояли лишь из 0,1 мл DMEM. Каждую лунку засевали равными объемами суспензии неочищенных клеток селезенки или Т-клеток с минимальной плотностью 5104 клеток и инкубировали в течение 72 часов при 37oС (5% СО2). В каждую лунку вносили аликвоту одного мкКи 3H-тимидина ([метил [3H]тимидин СА 74 ГБкммоль-1; Amersham) в 30 мкл DMEM с добавлением 10% ОСТ и инкубацию продолжали в течение 24 ч. Содержимое лунок собирали на стекловолоконные фильтры, применяя харвестер клеток (Titertek) и диски, представляющие каждую лунку, выбивали из прокладок фильтров в 1,5 мл сцинтилляционной жидкости (Cyoscint, ICN Biomedicals Inc.) для измерения включения 3H-тимидина в клетки. Индекс клеточной стимуляции рассчитывали из 4 воспроизведений как среднее число импульсов в минуту (после стимуляции)/(среднее число импульсов в минуту (в отрицательном контроле).

Получение рекомбинантного F1-антигена: клонирование cafl:ДHK выделяли из Y.pestis по методу Marmur et al. (1961) J.Mol.Biol. 3: стр.208-218. Фрагмент ДНК, кодирующий открытую рамку считывания cafl за исключением его сигнальной последовательности, амплифицировали из ДНК Y.pestis, применяя полимеразную цепную реакцию (ПЦР). Олигонуклеотиды для использования в ПЦР получали с помощью синтезатора ДНК Beckman 200А.

Конструкт pFGAL2a. Синтезировали олигонуклеотид GATCGAGCTCGGCAGATTTAACTGCAAGCACC (посл. ИД. 7), соответствующий первым 21 основанию гена cafl, следующих сразу за нуклеотидами, кодирующими сигнальную последовательность, с дополнительной 5'-областью, кодирующей сайт Sacl, и комплементарный олигонуклеотид CAGGTCGAGCTCGTCGACGGTTAGGCTCAAAGTAG (ПОСЛ. ИД. 8), соответствующий последовательности, которая кодирует предполагаемую "шпилькоподобную" структуру правее терминирующего кодона cafl, с добавленной 5'-областью, кодирующей сайты Sacl и Accl. Фрагмент ДНК получали после 35 циклов амплификации (95oС, 15 с; 50oС, 15 с; 72oС, 30 с, применяя Perkin Elmer 9600 GeneAmp PCR System). Фрагмент очищали, расщепляли с помощью Sacl и Accl, лигировали с подобным образом расщепленной плазмидой pUC18 и трансформировали E.coli JM109 путем электропорации. Электропорацию проводили, применяя Bio-Rad Gene Pulser с 0,2 см кюветами при 1,25 кВ, 25 мкФ, 800 Ом со значением временной постоянной, равным 20.

Колонию pFGAL2a, содержащую клонируемый ген cafl, идентифицировали с помощью ПЦР, применяя олигонуклеотид TGGTACGCTTACTCTTGGCGGCTAT (ПОСЛ. ИД. 9), соответствующий внутренней области от 128 до 153 нуклеотида гена от сайта, идентифицированного как сайт отщепления сигнальной последовательности (смотри Galyov et al. (1990)) и ПОСЛ. ИД. 2. Культуру E.coli, экспрессирующую F1, содержащую pFGAL2a, выращивали при 37oС с перемешиванием в Luria Broth. с 1 мМ изопропил--D-тиогалактопиранозидом (ИТГП) в течение 18 часов. Цельные клеточные лизаты и периплазматические и цитоплазматические фракции из бактерий получали, как описано Sambrook et al. (1989).

SDS-PAGE и вестерн-блоттинг: электрофорез в полиакриламидном геле (PAGE) с добавлением SDS и вестерн-блоттинг проводили, как описано Hunter et al. (1993) Infec. Immun. 61, 3958-3965. Блоты пробовали поликлональными антисыворотками, полученными от овец (В283) против убитых Y.pestis (штамм EV76, выращенный при 37oС), и связавшиеся антитела определяли с помощью антибараньего IgG осла, меченного пероксидазой хрена (Sigma).

Примеры 1 и 2 комбинации вакцин V/F1: сравнительные примеры: влияние вакцин на смертность мышей при контрольном заражении штаммом (GB) Y.pestis.

Животные: Barrier bred самок мышей Ва1b/с в возрасте 6 недель, свободных от мышиных патогенов, получали из Charles-River Laboratories, Margate, Kent, UK и использовали во всех данных примерах.

Иммунизация: мышей делили на группы по 5 или 6 мышей и иммунизировали следующим образом.

Сравнительная вакцина EV76: мыши общим числом 50 получали на 0 день расписания подкожно (п/к) однократную первично иммунизирующую дозу живой вакцины EV76, введенную в общем объеме 100 мкл.

Сравнительная вакцина Cutter USP: следующую группу из 50 мышей первично иммунизировали 100 мкл вакцины Cutter внутримышечно (в/м); причем данная доза представляет собой около 0,2 человеческой дозы и содержит приблизительно 2108 убитых формальдегидом бацилл чумы. Данную дозу повторно вводили каждому животному на 16 день расписания для проведения повторной иммунизации.

Вакцины F1 и V: группы из 62 мышей внутрибрюшинно (в/б получали первично иммунизирующую дозу либо рекомбинантного V-антигена, либо рекомбинантного F1-антигена, презентированного в 1:1 водомасляной эмульсии с неполным адъювантом Фройнда (НАФ; Sigma). Животных первично иммунизировали дозой соответствующего антигена в 10 мкг в общем объеме 0,1 мл эмульсии. Животных повторно иммунизировали дозой соответствующего антигена на 14 (группы V и F1) и 28 (вся группа F1 и подгруппа из 12 животных из группы V) дни.

Следующую группу из 12 мышей первично и повторно иммунизировали на 0, 14 и 28 дни комбинацией 10 мкг F1 и 10 мкг V, совместно включенных в состав водной фазы 1:1 водомасляной эмульсии с НАФ (конечный объем 0,1 мл на мышь).

На 50 день расписания иммунизации из каждой обрабатываемой группы случайным образом выбирали 6 животных для дальнейшего анализа ответов клеток селезенки. Остальных животных из каждой группы подвергали контрольному заражению Y. pestis. Сходным образом отделяли необрабатываемую контрольную группу равновозрастных мышей.

Контрольное заражение многократными LD в целях определения порога защиты: мышей из каждой иммунизированной группы и необработанного контроля разбивали на группы по 5 или 6 мышей для подкожного (п/к) контрольного заражения штаммом GB Y. pestis в интервале дозировок от 20 до 2109 жизнеспособных микроорганизмов. За подвергнувшимися контрольному заражению мышами внимательно наблюдали в течение 14-суточного периода на предмет развития симптоматики, а где оказывалось необходимым, аккуратно регистрировали время до смерти.

Животных, погибших в результате контрольного заражения, вскрывали и брали мазки крови, печени и селезенки на бактериологические анализы.

Результаты данных контрольных заражений контрольных и тестируемых животных приведены в таблице 1 ниже; причем даны два ряда результатов, соответствующих двум сериям экспериментов с соответствующими контролями. Из данных результатов легко заметить, что тогда как V-антиген является более эффективным, чем Cutter, он все же уступает EV76. Однако, будучи объединенным с менее эффективным F1, он образует комбинацию, эффективную в той же мере, что и EV76, без побочных эффектов.

ПРИМЕР 3

Получение ослабленной Salmonella для применения в пероральной вакцине

Экспрессия рекомбинантного V-антигена в S.typhimurium и typhi.

Амплифицированный ген IcrV клонировали в три различных плазмидных вектора:

pMAL-p2: вектор, предназначенный для экспрессии клонируемого гена в виде продукта слияния с белком, связывающим мальтозу (БСМ). С-конец БСМ слит с N-концом V-антигена. Полученный таким образом при экспрессии белок транспортируется в периплазму. Вектор, содержащий последовательность ДНК V-антигена обозначили как pVMP100.

pMAL-c2: вектор, сходный с pMAL-p2 за исключением того, что гибридный белок MBP-V-антиген экспрессируется в цитоплазме. Рекомбинантную плазмиду обозначили как pVMC100.

pGEX-5X-2: вектор, предназначенный для экспрессии клонируемого гена в виде белка, слитого с глютатион-S-трансферазой (GST). С-конец GST слит с N-концом V-антигена и гибридный белок экспрессируется в цитоплазме. Рекомбинантную плазмиду обозначили как pVG100.

Все векторы содержат промотор Рtac и ген laclQ; причем последний кодирует репрессор lac, который прекращает транскрипцию Рtac у Escherichia coli до тех пор, пока не будет добавлен ИТГП. Плазмиды содержат область начала репликации с pBR322, и как результат в бактериальной клетке реплицируется низкое количество копий.

Каждую рекомбинантную плазмиду электропорировали в штамм SL 3261 Salmonella typhimurium, ослабленный штамм, который интенсивно применяется в качестве переносчика в живой вакцине для экспрессии чужеродных антигенов. Он содержит специфическую мутацию - делецию - в гене аrоА, которая делает мутанта зависимым от определенных ароматических соединений, которые требуются ему для роста (смотри Hosieth et al.). Для получения микроорганизма, пригодного для применения в вакцинации человека, электропорацию производят в ослабленную Salmonella typhi.

Все рекомбинантные плазмиды экспрессируют V-антиген, как показано с помощью вестерн-блоттинга культур S. typhimurium и мечения моноспецифической анти-V-антигенной поликлональной антисывороткой, поставляемой R.Brubaker, Dept. Microbiology, Michigan State University, East Lancing, MI 48824-1101, USA. Рекомбинантную S. typhimurium вводили внутривенно мышам в количестве 5107 КОЕ/доза, и для них были показаны высокие уровни заселения печени и селезенки; было выделено от 8106 до 5108 КОЕ на орган. Большинство выделенных бактериальных клеток были также устойчивыми к ампициллину, что указывает на сохранение рекомбинантных плазмид.

Экспрессия F1 в S.typhimurium: Плазмиду pFGAL2a выделяли, применяя стандартные методики, описанные Sambrook et al. (1989) Molecular Cloning; a Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratory, New York. Очищенную плазмиду электропорировали в S.typhimurium LB5010 (рестрикция-, модификация+) и метилированную pFGAL2a в последующем выделяли из LB5010 для электропорации в S. typhimurium SL3261 (аrоА-). Периплазматическую и цитоплазматическую фракции подготавливали для SDS-ЭПАГ и вестерн-блоттинга, как описано выше.

Устойчивость конструктов: пяти самкам мышей Balb/c вводили внутривенно либо 5105 либо 5107 КОЕ S.typhimurium, содержащих pFGAL2a в 200 мкл фосфатно-буферного раствора. Контрольным мышам подобным образом вводили S.typhimurium, содержащую рuС18 без вставок. Через 7 дней мышей забивали путем сворачивания шеи и брали их печени и селезенки. Органы гомогенизировали в 10 мл фосфатно-буферного раствора, применяя stomacher в максимальном режиме в течение 2 минут и гомогенат серийно разводили в фосфатно-буферном растворе и помещали на L-агар или L-агар, содержащий 55 мкгмл-1 ампициллина.

Конструкт F1-оперона: попытки реплицировать целый F1-оперон с помощью ПЦР в виде единого фрагмента были безуспешны, так что была разработана стратегия, посредством которой его амплифицировали, применяя ПЦР, с получением двух отдельных фрагментов с применением пар праймеров (а) ПОСЛ. ИД. 12 и 13 и (б) ПОСЛ.ИД. 14 и 15 соответственно для получения фрагментов размером в 3,36 кбайт и 1,89 кбайт с матрицы ДНК Y.pestis MP6. Экстракт ДНК по Marmur применяли без очистки СsСl2. Применявшиеся условия проведения ПЦР представляли собой 96oС в течение 30 секунд, 57oС в течение 30 секунд и 72oС в течение 1 минуты; суммарно 30 циклов.

Данные два фрагмента расщепляли, применяя Nhel, и объединяли вместе.

Слитый фрагмент, кодирующий оперон по всей длине (5,25 кбайт), расщепляли с помощью EcoRI и Sall и затем клонировали в ряд векторов. Когда данный фрагмент клонировали в pBR322 и экспрессировали в E.coli, S.typhimurium LB5010 или SL3261, была замечена неустойчивость рекомбинантной плазмиды. Чтобы избежать данной проблемы, оперон клонировали в плазмиде pLG339, низкокопийной плазмиде kmR. Единый F1-оперон также вставляли в ген АrоС в хромосоме S. typhimurium, применяя вектор pBRD1084. Список последовательностей см. в конце описания.

Как обсуждалось ранее в данной заявке: V- и F1-антигены могут быть микроинкапсулированы. V- и F1-антигены могут быть микроинкапсулированы по отдельности. Объединенные микроинкапсулированные субъединицы могут быть применены для иммунизации. Авторы настоящего изобретения убеждены, что защита, достигаемая с помощью объединенных микроинкапсулированных субъединиц, превосходит защиту, обеспечиваемую существующими противочумными вакцинами, и что объединением субъединиц достигается дополнительный эффект. Эффективность защиты с помощью объединенных микроинкапсулированных субъединиц может быть еще более усовершенствована путем совместного введения адъюванта, например субъединицы В холерного токсина (ХТВ). Микроинкапсулирование вакцины на основе субъединиц продлевает срок высвобождения вакцины in vivo, делает возможным пероральное, интраназальное или ингаляционное введение и расширяет круг возможных мишеней.

Микроинкапсулирование вакцины на основе объединенных V-и F1-субъединиц описано ниже. Также продемонстрировано, что данный состав способен индуцировать как слизистый, так и системный иммунитет против чумы.

Микроинкапсулирование субъединиц проводили в PLA 2000, применяя методику выпаривания растворителя.

Иммунизацию микроинкапсулированными частицами проводили следующим образом.

Группы по 25 мышей получали первично иммунизирующую дозу в 25 мкг либо V-антигена, либо F1-антигена, презентированного в микросферах, ресуспендированных в ФБР для внутрибрюшинных инъекций. Другие группы по 21 мыши получали комбинацию по 25 мкг F1- и V-антигенов, презентированных в микросферах. Дозу в 25 мкг F1 вводили в общей массе 5,42 мг сфер, тогда как 25 мкг V содержались в 2,08 мг сфер. Требуемую массу микросфер ресуспендировали для инъекции в 100 мкл ФБР на животное. Животных повторно иммунизировали соответствующим(и) антигеном(ами) на 14 и 28 дни.

Еще две группы по 21 мыши первично, а затем вторично иммунизировали в/б на 14 и 28 дни комбинацией 10 мкг F1 и 10 мкг V, совместно включенных в водную фазу 25% (по объему) суспензии alhydrogel (Alhydrogel 1,3%, Superfos, Denmark) в ФБР.

Избранные группы животных получали в дополнение дозу в 10 мкг СТВ (Sigma, Poole), включенного в носитель при каждой дозировке.

Контрольные группы, каждая из которых состояла из 21 мыши, получали либо только alhydrogel (100 мкл 25% раствора), либо только СТВ (10 мкг в 100 мкл ФБР), либо не обрабатывались вообще.

В целях сравнения защитной эффективности иммунизации объединенными субъединицами, свободными или микроинкапсулированными, с эффективностью защиты, обеспечиваемой вакциной по Greer (полученной из Greer Laboratories), животных подвергали п/к контрольному заражению вирулентной Y.pestis.

Среди животных, вакцинированных по Greer, индекс выживаемости составил 60% при контрольном заражении 2105 КОЕ Y.pestis (фиг.1). В сравнение с этим среди животных, вакцированных объединенными микроинкапсулированными Fl+V (группа 1), при данном уровне контрольного заражения выжило 80% особей, а в группе 2 (V+Fl+10 мкг СТВ) выживаемость составила 100%. Таким образом, объединенный микроинкапсулированный состав обеспечивал защиту от вирулентной Y.pestis без каких-либо проявлений побочных эффектов.

Вкратце, обрабатываемые группы представляли собой:

1. 25 мкг микроинкапсулированного F1 (F1) + 25 мкг микроинкапсулированного V (V) в/б;

2. 25 мкг F1+25 мкг V+10 мкг СТВ в/б;

3. 25 мкг F1 в/б;

4. 25 мкг V;

5. 25 мкг F1+25 мкг V в alhydrogel в/б;

6. Вакцина по Greer 0,1 мл в/м.

Микроинкапсулирование может быть проведено с помощью блоксополимеров, в следующих экспериментах в качестве модели применяли белковый антиген БСА. Получение и охарактеризование микросфер проводят следующим образом. Загруженные белком микросферы получали в соответствии с процедурами методики выпаривания масляно-водного растворителя, описанной ранее, смотри R.L.Hunter and Bennet B., The J.Immunol., 133 (6), 3167-3175 (1984), с некоторыми модификациями. Раствор полимера (поли-D-молочной кислоты: Resomer 206, Boehringer Ingelheim, Germany; 125 или 250 мг) в ацетоне (22,5 мл), содержащем модельный белок (антиген). БСА (15-25% от теоретического уровня загрузки) и 0,11% м/о Pluronic L101 (или 0,09% м/о L121), полученный от Zeneca probe, озвучивали ультразвуком в течение 10 секунд и затем добавляли в водную фазу (22,5 мл), перемешивая при 100 об/мин в течение 5 минут, и подвергали роторному испарению до тех пор, пока органический растворитель не был удален. Полученный коллоид промывали и сушили вымораживанием. Микросферы среднего диаметра ~ 1 мкм (что было определено с помощью Malvern Mastersizer) и загрузку белка ~ 0,5-1,0% производили в данных условиях получения. Внешнюю морфологию полученных микросфер анализировали с помощью сканирующей электронной микроскопии (СЭМ). Поверхностные характеристики определяли с точки зрения дзета-потенциала и гидрофобности.

Измерения гидрофобности: гидрофобность микросфер количественно анализировали с помощью гидрофобной хроматографии (ГХ), как сообщалось ранее, смотри H. O. Alpar and A.J.Almeida, Eur.J.Pharm.Biopharm, 40, (4), 198-202 (1994). Микросферы снимали с серии агароз, которые были модифицированы гидрофобными остатками. Время удержания микросфер на октилагарозе принимали за показатель гидрофобности.

Иммунизация: исследование было призвано установить влияние различий в типе микросфер и поверхностных характеристик на иммунный ответ. Самкам мышей Balb/c (пяти на группу) в/м вводили разовую дозу либо БСА, инкапсулированного в микросферы, образованные Pluronic, либо только свободного БСА в 100 мкл, либо суспендированного в присутствии поверхностно-активного вещества. Контрольная группа мышей получала то же количество антигена, инкапсулированного в микросферы, содержащие PVA в качестве стабилизатора эмульсии. Периодически в течение 2 месяцев брали образцы крови из кончика хвоста. Сыворотку из каждого образца анализировали на предмет анти-БСА антител, применяя твердофазный иммуноферментный анализ (ELISA). Результаты представлены в графическом виде на фиг. 2.

Присутствие Pluronic L101 и L121 наделяет поверхность гораздо большим уровнем гидрофобности по сравнению с PVA-содержащими составами (70% удержанных микросфер на октилагарозной колонке в отличие от 95% удержания на 30% латексной колонке). Гидрофобная поверхность будет облегчать взаимодействия макрофагов и последующий фагоцитоз и, таким образом, будет являться гораздо более пригодной для опосредования, усиленного иммунного ответа. Фиг. 2 показывает влияние различных БСА-содержащих составов на индукцию иммунного ответа. Пробы, полученные с применением Pluronic L101, обладали более сильным влиянием на титр анти-БСА антител в плазме, чем пробы, полученные с применением PVA. Пробы, полученные с применением Pluronic L121, слегка уступали пробам с PVA-содержащими микросферами в индуцировании мощного первичного антительного ответа после введения лишь малой дозы антигена (1 мкг). Отмечается более высокий уровень содержания IgG в сыворотке, достигнутый с применением Pluronic L101-coдержащих препаратов по сравнению с другими препаратами, и это может отчасти быть следствием большей гидрофобности поверхности.

Также ранее в настоящей заявке было указано, что ДНК, кодирующая весь или части F1-антигена, или ДНК, кодирующая весь или часть V-антигена, может быть непосредственно применена в качестве генетической вакцины. В порядке примера, это может быть выполнено следующим образом.

1) ДНК, кодирующую F1 и V Y.pestis, получают путем амплификации специфических участков генома Y.pestis с помощью полимеразной цепной реакции (ПЦР) или путем выделения данных генов из предварительно сконструированных плазмидных клонов, например, для V-приведенной последовательности ИД. 3.

2) Гены F1 и V клонируют в экспрессирующие векторы-плазмиды млекопитающего так, чтобы данные гены были расположены правее эукариотического промотора. Подходящие плазмиды включают pCMV (полученную от Clontech), в которой применяют непосредственный ранний промотор цитомегаловируса. F1 и V могут клонироваться по отдельности или в комбинации и могут клонироваться в виде продуктов слияния с такими генами, как последовательность, кодирующая глютатион-5-трансферазу, или сигнальная последовательность эукариот, которые могут стабилизировать экспрессируемый белок и облегчить его транспорт из клеток млекопитающих.

3) Рекомбинантные плазмиды размножают в Escherichia соli и сырой продукт очищают для трансфекции модели млекопитающего и для внутримышечной или внутрикожной или ингаляционной иммунизации экспериментальных животных.

ПРИМЕР 4

Для создания ДНК-вакцины, экспрессирующей V-антиген, плазмидный вектор pCMV расщепляли с помощью рестриктазы Not 1 для удаления кодирующей последовательности гена lacz. Расщепленную плазмиду обрабатывали ферментом Klenow для получения тупоконечной векторной ДНК. Рестрикт ssp 1, содержащий кодирующую последовательность гибридного белка V-антигена и глютатион-S-трансферазы, выделяли из рекомбинантной плазмиды pVG100 и лигировали с векторной ДНК. Последовательность, кодирующая V, применяемая в данном случае представляет собой последовательность, описанную в приведенной ПОСЛ. ИД. 3. Рекомбинантной плазмидой трансформируют штамм Nova Blue E. coli. Очищенную плазмиду прививали мышам Ва1b/с с помощью внутримышечной инъекции. Иммуноглобулиновые ответные реакции на V-антиген определяли в сыворотке привитых животных.

ПРИМЕР 5

Для создания ДНК-вакцины, экспрессирующей F1-антиген, предназначались праймеры ПЦР для полной амплификации открытой рамки считывания cafl. Он кодирует F1 и его сигнальный

пептид, который направляет транспорт белка из бактериальной клетки. Праймеры ПЦР имели на 5'-концах "хвосты",которые содержали сайты узнавания рестриктаз для обеспечения направленного встраивания в плазмидный вектор. Последовательности праймеров ПЦР, 5'FAB2 и 3'FBAM, даны в приведенной ПОСЛ. ИД. 18 и ПОСЛ. ИД. 19 соответственно.

5'FAB2 и 3'FBAM применяли для амплификации ПЦР-фрагмента, последовательность которого приведена в ПОСЛ. ИД. 20. ПЦР-фрагмент расщепляли с помощью рестриктаз Nhe 1 и Bam H1 и клонировали в плазмиде pBKCMV, которую расщепляли теми же ферментами. Полученной плазмидой, pFlAB, трансформировали Е. coli Nova Blue и очищенную плазмиду применяли для привития мышам Ва1b/с с помощью внутримышечной инъекции. У привитых животных обнаруживали иммуноглобулиновые ответные реакции на F1.

ПРИМЕР 6

Для создания ДНК-вакцины, экспрессирующей как F1, так и V, кодирующую последовательность V встраивали в ДНК-вакцину, экспрессирующую F1, подробно описанную в примере 2. Между кодирующими последовательностями F1 и V помещали линкерную область, кодирующую 6 аминокислот, для того чтобы оба белка достигали своей конформационной структуры независимо друг от друга. Линкер-V-кодирующую последовательность получали путем расщепления рекомбинантной плазмиды placFV6 с помощью Bam H1 и Hind III. Линкер-V-ДНК лигировали с плазмидой pF1AB, которую также расщепляли с помощью Ваm H1 и Hind III. Полученной плазмидой, pFVAB, трансформировали клетки E.coli Nova Blue и неочищенные плазмиды очищали для дальнейшего применения. Нуклеотидная и производная аминокислотная последовательности продукта слияния F1/V даны в приведенной ПОСЛ. ИД. 22.

Пример гибридного белка, содержащего как F1-, так и V-антигены, описан ниже.

Ферменты и реактивы

Материалы для приготовления сред для выращивания получали из Oxoid Ltd. или Difco Laboratories. Все ферменты, применявшиеся для манипуляций с ДНК, получали из Boehringer Mannheim UK Ltd. и применяли в соответствии с инструкциями производителя. Все остальные химические и биохимические реактивы получали из Sigma Chemical Co, если только не указывается особо. Моноспецифичную кроличью поликлональную анти-V сыворотку получали от Dr. R.Brubaker (Department of Microbiology, Michigan State University) и мышиный анти- F1 моноклональные антитела (MAT) IgA F13G8-1 получали из American Type Culture Collection.

Штаммы бактерий и культивирование

Yersinia pestis GB культивировали в аэробных условиях при 28oС в жидкой среде (рН 6,8), содержащей 15 г протеолитического пептона, 2,5 г гидролизата печени, 5 г дрожжевого экстракта, 5 г NaCl на литр с добавлением 80 мл 0,25% гемина, растворенного в 0,1М NaOH (Blood Base Broth). Escherichia coli JM109 культивировали и хранили, как описана Sambrook et al. (Sambrook J. et al. 1989, Molecular Cloning, a Laboratory Manual. Cold Spring Harbor, Laboratory Press, New York).

Манипуляции с ДНК

Хромосомную ДНК выделяли из Y.pestis по методу Marmur (Marmur, J. 1961, J. Kol. Biol. 3: 208-218). Гены, кодирующие F1-антиген (cafl) и V-антиген (IcrV), амплифицировали из ДНК Y.Pestis, применяя полимеразную цепную реакцию (ПЦР) с использованием 125 пмоль праймеров, гомологичных последовательностям между 5'- и 3'-концами гена (Galyov, E.E. et al. 1990. FEBS Lett. 277: 230-232; Price S.B. et al. 1989. J. Bacteriol. 171: 5646-5653), хотя для cafl амплифицировали только область, кодирующую зрелый F1-антиген. Последовательности 5'-праймера F1 (F/5'B: GATCGAGCTCGGCAGATTTAACTGCAAGC-АСС), 3'-праймера F1 (Flink/3'A: GCATGGATCCTTGGTTAGATACGGTTACGGT), 5' -праймера V (Vlink/5'A: ATGGATCCATCGAAGGTCGTATTAGAGCCTACGAACAA)) и 3'-праймера V (VG/3'A: GCATAAGCTTCTA*GT GTCATTTACCAGACGT) также включают в себя 5'-хвосты, кодирующие сайты рестрикции Sacl, BamHI, BamHI и HindIII соответственно. В дополнение к этому, нуклеотид А* был изменен по сравнению с опубликованной последовательностью IcrV (Price S.B. et al. 1989. J.Bacteriol. 171: 5646-5653) так, что он стал включать дополнительный терминирующий кодон (ТАА) в амплифицированной ДНК. Хвост праймера Vlink/5'A также включал в себя нуклеотиды, кодирующие последовательность отщепления фактора Ха Ile-Glu-Gly-Arg. ПЦР-праймеры получали с помощью синтезатора ДНК (модель 392; Applied Biosystems). Фрагменты ДНК получали после 30 циклов амплификации (95oС, 20 с, 45oС, 20 с, 72oС, 30 с; GeneAmp PCR System модели 9600; Perkin Elmer) и фрагменты очищали. Продукт ПЦР cafl расщепляли с помощью Sacl и BamHI, лигировали с надлежащим образом расщепленной плазмидой puC18 и трансформировали Е. coli JM109 путем электропорации. В дальнейшем, продукт ПЦР IcrV-линкера расщепляли с помощью BamHI и HindIII и лигировали с промежуточной плазмидой с образованием рекомбинантной плазмиды placFV6. Колонию, содержащую placFV6, идентифицировали с помощью ПЦР, применяя 30-mer праймеры (5'-нуклеотиды, расположенные в положениях 54 и 794 (Price S.B. et al., 1989. J. Bacteriol. 171: 5646-5653), которые амплифицируют внутренний сегмент гена IcrV. Для подтверждения нуклеотидной последовательности клонируемой вставки проводили реакции секвенирования, задействующие placFV6 и праймеры, соответствующие генам cafl и IcrV, применяя протокол автоматизированного секвенирования с применением Taq-полимеразного цикла с помощью меченных флюоресцентной меткой дидезоксинуклеотидов (CATALYST Molecular Biology Labstation; Applied Biosystems). Продукты реакции анализировали, применяя автоматизированный секвенатор ДНК (модель 373А; Applied Biosystems).

Последовательность ДНК и производная аминокислотная последовательность клонируемого гибридного белка показана в примере 1. Гибридный белок состоит из F1- и V-антигенов, разделенных сшивкой, состоящей из шести аминокислот Gly-Ser-lle-Glu-Gly-Arg. Его клонируют правее промотора lac и в одной рамке с кодируемым вектором фрагментом LacZ'. Таким образом, полный гибридный белок содержит девять дополнительных аминокислот на N-конце (Met-Thr-Met-Ile-Thr-Asn-Ser-Ser-Ser) и накапливается в цитоплазме.

Экспрессия слитого белка F1/Vy E.coli

Культуры E.coli JM109/placFV6 выращивали на LB, содержащем 1000 мкгмл-1 ампициллин, при 37oС до тех пор, пока поглощение (600 нм) не становилось равным 0,3. Затем к культуре добавляли изопропил--D-тиогалактопиранозид (ИТГП) до конечной концентрации 1 мМ и выращивание продолжали в течение последующих 5 часов. Цельные клеточные лизаты бактерий получали, как описано в Sambrook et al. (Sambrook J. et al. 1989, Molecular Cloning, a Laboratory Manual. Cold Spring Harbor, Laboratory Press, New York) и экспрессию гибридного белка F1/V исследовали путем SDS-ЭПАГ на 10-15% градиентных гелях (Phastsystem, Pharmacia Biotech) и вестерн-блоттинга (Sambrook J. et al. 1989, Molecular Cloning, a Laboratory Manual. Cold Spring Harbor, Laboratory Press, New York). Отпечатки метили с помощью кроличьей анти-V сыворотки в разведении 1/4000 или Mab F13G8-1 в разведении 1/250 и белковые ансамбли визуализировали с помощью вторичных антител, меченных коллоидным золотом (Auroprobe BLplus, Cambio) или антимышечных вторичных антител IgA, конъюгированных с пероксидазой хрена (Sigma).

В лизатах JM109/placFV6 путем вестерн-блоттинга с анти-V- и анти-F1-сыворотками определяли гибридный белок с приблизительной молекулярной массой 54,2 кДа. Данный продукт не определялся в контрольных лизатах JMl09/pUC18.

Электропорация в Salmonella typhimurium SL3261

Плазмидную ДНК экстрагировали и очищали из JM109/ placFV6, применяя кит Qiaprep (Qiagen), и электропорировали в штамм LB5010 S.typhimurium (r-m+). Далее, модифицированную placFV6 выделяли и электропорировали в штамм SL3261 S. typhimurium (aroA his). Для прививания мышам бактерии выращивали на LB, содержащем 100 мкгмл-1 ампициллин, в течение 18 часов без перемешивания. После промывания клетки ресуспендировали в 10% глицерине в фосфатно-буферном растворе (ФБР) и хранили при -70oС. Клеточные суспензии размораживали и, при необходимости, разводили в ФБР перед инъекцией.

Иммунизация rV

В данном исследовании применяли самок мышей Ваlb/с в возрасте шести недель, выращенных в особых условиях, свободных от патогенов (Charles River Laboratories, Margate Kent, UK). Группа из 19 мышей внутривенно (в/в) получала 0,2 мл первично иммунизирующие дозы приблизительно 5106 КОЕ SL3261/pFV6 на 0 и 14 дни. Для сохранения placFV6 in vivo мышам также подкожно (п/к) вводили 50 мкл суспензии ампициллина тригидрата (150 мгмл-1 ; Penbritin injectable suspension РОМ; SmithKline Beecham Animal Health) в течение 5 дней после каждой иммунизации. В дополнение к этому, группы по 15 мышей иммунизировали в/в на 0 день разовой 0,1 мл дозой приблизительно 5106 КОЕ SL3261 или внутрибрюшинно (в/б) на 0 и 14 дни 0,1 мл смеси 10 мкг V и 10 мкг F1, адсорбированных на Alhydrogel. Необрабатываемую группу из 10 одновозрастных мышей применяли в качестве контроля.

На 7 день пять мышей из групп, получавших SL3261/pFV6 или SL3261, забивали и их селезенки отбирали. Органы гомогенизировали в 5 мл ФБР с помощью stomacher (Seward Medical Ltd.) в течение 30 с. Гомогенаты серийно разводили в ФБР и сеяли на L-агар или L-агар, содержащий 100 мкгмл1 ампициллина, для определения числа бактерий на селезенку (см. табл. 2)

Измерение титра сывороточных антител

На 42 день отбирали образцы крови из хвостовой вены мышей, иммунизированных SL3261/placFV6, и образцы группировали. Титры сывороточных анти-V- и анти-F1-антител измеряли с помощью модифицированного ELISA (Williarason,E.D. and R.W.Titball. 1993. Vaccine 11: 1253-1258). Вкратце, V (6 мкгмл-1 в ФБР) или F1 (2 мкгмл-1) наносили на планшет для микротитрования и на планшете в двойном экземпляре готовили серии разведений тестируемых сывороток. Связавшиеся антитела определяли, применяя конъюгаты антимышиных поливалентных Ig, меченных пероксидазой. Титр специфичных антител определяли как максимальное разведение сыворотки, позволяющее получить показатель поглощения больше чем 0,1 единицы, после вычитания поглощения, имеющего место при неспецифическом связывании, определенного в контрольных сыворотках. Титр сывороточных антител также определяли во всех группах мышей до контрольного заражения Y.pestis.

На 42 день титры анти-V- и анти-F1-антител у мышей, получавших SL3261/placFV6, составили 1:5120 и 1:2560 соответственно.

Контрольное заражение Y.pestis

На 57 день группы по 5 или 7 мышей из иммунизированных и контрольных групп подвергали подкожному контрольному заражению 0,1 мл аликвотами штамма GB Y. pestis, содержащими 7,36102 или 7,36104 КОЕ. Штамм GB выделяли из организма смертельно заболевшего чумой человека, и его подкожная среднелетальная доза (MLD) для мышей Ва1b/с составляет <1 КОЕ (Russel, P.et al. 1995. Vaccine 13: 1551-1556). Мышей наблюдали в течение 14 дней и, если возникала необходимость, регистрировали время до смерти. Для тестирования на предмет присутствия Y. pestis образцы крови, печени и селезенки высевали на агар с конго красным и инкубировали при 28oС в течение 48 часов (см. таблицу 3). 


ФОРМУЛА ИЗОБРЕТЕНИЯ



1. Вакцинная композиция, предназначенная для защиты от инфекции микроорганизма Yersinia pestis, содержащая иммуногенно эффективное количество V-антигена Yersinia pestis, или его защитной эпитопной части или экспрессирующей их живой вакцины и иммуногенно эффективное количество F1-антигена Yersinia pestis, или его защитной эпитопной части, или экспрессирующей их живой вакцины, причем живая вакцина содержит микроорганизмы, относящиеся к роду, отличному от Yersinia pestis.

2. Вакцина по п.1, отличающаяся тем, что она представляет собой живую вакцину.

3. Вакцина по п.2, где указанная живая вакцина содержит микроорганизмы, заселяющие кишечник человека или животного, которые были трансформированы с применением рекомбинантной ДНК так, чтобы каждый микроорганизм становился способен экспрессировать один или оба из V-антигена и F1-антигена.

4. Вакцина по п.3, где указанные микроорганизмы, заселяющие кишечник, трансформируют рекомбинантной ДНК так, что они становятся способны экспрессировать гибридный белок, содержащий аминокислотные последовательности как V-антигена, так и F1-антигена или защитную эпитопную часть каждого из них.

5. Вакцина по п.3 или 4, где указанная ДНК содержит ДНК, обладающую SEQ ID N0: 1 или 3.

6. Вакцина по п.5, где указанная ДНК расположена в рамке с промотором lacz или nir.

7. Вакцина по п.3 или 4, где указанная ДНК содержит ДНК, обладающую SEQ ID N0: 10.

8. Вакцина по п.1, где указанная вакцина содержит выделенные и/или очищенные рекомбинантные V-антиген и F1-антиген.

9. Вакцина по п.8, где указанные антигены представлены в фармацевтически приемлемом носителе.

10. Вакцина по п.9, где указанный носитель представляет собой масляно-водную эмульсию.

11. Вакцина по любому из предшествующих пунктов, где указанная вакцина включает в себя адъювант.

12. Вакцина по любому из предшествующих пунктов, где указанная вакцина находится в форме капель или капсул.

13. Вакцина по п.12, где указанные капсулы представляют собой липосомы или микрокапсулы, эффективно доставляющие композицию в дыхательные пути индивидуума в целях индукции иммунного ответа в слизистой оболочке.

14. Вакцина по п.12, где указанные капсулы представляют собой блоксополимеры.

15. Вакцина по п.12, где указанные капсулы содержат полимеры, поддающиеся биологическому разрушению.

16. Вакцина по п.15, где указанным полимером, поддающимся биологическому разрушению, является полимолочная кислота.

17. Вакцина по п.16, кроме того содержащая гликолевую кислоту.

18. Вакцина по п.16, кроме того содержащая блоксополимер.

19. Вакцина по п.14 или 15, в которой указанный блоксополимер содержит повторяющееся звено (ПОП-ПОЭ)n.

20. Вакцина по п.5, где указанная ДНК расположена в рамке с индуцибельным in vivo промотором.

21. Вакцина по п.20, где указанный индуцибельный in vivo промотор выбран из htrA, nir, OmpR, OmpC, PhoP.

22. Вакцина по п.5, где ДНК расположена в рамке с конститутивным промотором.

23. Вакцина по п.22, где указанный конститутивный промотор представляет собой Osmz или lacz.

24. Вакцина по п.3 или 4, где указанная ДНК содержит ДНК, обладающую SEQ ID N0:7, или 8, или 9.

25. Вакцина по п.3 или 4, где указанная ДНК содержит ДНК, обладающую SEQ ID N0:16.

26 Вакцина по п.3 или 4, где указанная ДНК содержит ДНК, обладающую любой из SEQ ID N0:1, 3, 10.

27. Вакцина по п.4, где указанная ДНК содержит ДНК, обладающую SEQ ID N0: 20 или 22.

28. Вакцина по п.27, где указанная ДНК расположена правее эукариотического промотора.

29. Вакцина по п.28, где указанный эукариотический промотор представляет собой предранний промотор CMV.

30. Вакцина по п.9, где носителем является вода.

31. Способ защиты человека или животного от воздействия инфекции Yersinia pestis, предусматривающий введение указанному человеку или животному вакцины, охарактеризованной в пп.1-30.