РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pSS5, КОДИРУЮЩАЯ СИНТЕЗ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА, ШТАММ ESCHERICHIA COLI SS5 - ПРОДУЦЕНТ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА И СПОСОБ ПОЛУЧЕНИЯ ИНТЕРФЕРОНА АЛЬФА-2b

РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pSS5, КОДИРУЮЩАЯ СИНТЕЗ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА, ШТАММ ESCHERICHIA COLI SS5 - ПРОДУЦЕНТ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА И СПОСОБ ПОЛУЧЕНИЯ ИНТЕРФЕРОНА АЛЬФА-2b 


RU (11) 2165455 (13) C1

(51) 7 C12N15/21, C12N1/21, C12P21/02, C12P21/02, C12R1:19 

(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ РОССИЙСКОЙ ФЕДЕРАЦИИ 
Статус: по данным на 15.02.2008 - прекратил действие, но может быть восстановлен 

--------------------------------------------------------------------------------

(21) Заявка: 99124276/13 
(22) Дата подачи заявки: 1999.11.23 
(24) Дата начала отсчета срока действия патента: 1999.11.23 
(43) Дата публикации заявки: 2001.04.20 
(45) Опубликовано: 2001.04.20 
(56) Список документов, цитированных в отчете о поиске: RU 2054041 C1, 10.02.1996. RU 2118366 C1, 27.08.1998. WO 92/01055 A, 23.01.1992. EP 0422697 A, 17.04.1991. 
(71) Заявитель(и): Государственный научно-исследовательский институт особо чистых биопрепаратов (RU); Акционерное общество закрытого типа Научно-производственная компания "ДиапрофМЕД" (UA); Закрытое акционерное общество "СоюзАгромед" (RU); Государственный научный центр прикладной микробиологии (RU) 
(72) Автор(ы): Черепанов П.А. (RU); Михайлова Т.Г. (RU); Черепанов П.П. (RU); Мартиненко Дмитрий Леонидович (UA); Шевчук Александр Анатольевич (UA); Федюкин В.С. (RU); Николаев Т.М. (RU); Толкачев Б.Б. (RU); Свентицкий Е.Н. (RU); Ураков Н.Н. (RU); Калинин Ю.Т. (RU); Денисов Л.А. (RU); Тяготин Ю.В. (RU); Мартюшин С.В. (RU); Ищенко А.М. (RU); Трофимов А.В. (RU); Полякова Е.А. (RU); Батарин В.И. (RU); Шалаева О.Н. (RU); Лисицкая В.И. (RU) 
(73) Патентообладатель(и): Государственный научно-исследовательский институт особо чистых биопрепаратов (RU); Акционерное общество закрытого типа Научно-производственная компания "ДиапрофМЕД" (UA); Закрытое акционерное общество "СоюзАгромед" (RU); Государственный научный центр прикладной микробиологии (RU) 
Адрес для переписки: 193313, Санкт-Петербург, ул. Подвойского, д.14, корп.1, кв.741, Кузнецову В.А. 

(54) РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pSS5, КОДИРУЮЩАЯ СИНТЕЗ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА, ШТАММ ESCHERICHIA COLI SS5 - ПРОДУЦЕНТ РЕКОМБИНАНТНОГО ЧЕЛОВЕЧЕСКОГО АЛЬФА-2b ИНТЕРФЕРОНА И СПОСОБ ПОЛУЧЕНИЯ ИНТЕРФЕРОНА АЛЬФА-2b 

Изобретение относится к биотехнологии и может быть использовано для получения рекомбинантного лейкоцитарного интерферона альфа 2b человека медицинского назначения (ИНТ). Рекомбинантной мультикопийной плазмидной ДНК pSS5, кодирующей синтез лейкоцитарного альфа -2b интерферона человека, экспрессия которого находится под контролем лактозного, фага Т7 и триптофанового промоторов и терминатора транскрипции rrn BT1T2, содержащей ген устойчивости к канамицину и содержащей фрагмент ДНК из плазмиды pUC19, ответственный за репликацию рекомбинантной плазмиды, трансформируют клетки реципиентного штамма Е. coli BL 21(DE3). Получают штамм Е. coli SS5 с продуктивностью не менее 800 мг альфа -2b интерферона с суммарной активностью 1-2х1011 ME на 1 л культуральной среды или 15-20 г влажной биомассы клеток штамма. Способ предусматривает культивирование на питательной среде, замораживание культуральной жидкости при температуре не выше -70°С, ее размораживание при повышении температуры до 4°С, введение в культуральную жидкость лизоцима, удаление ДНК и РНК обработкой лизата ДНК-азой, концентрирование полученного продукта отмывкой белка растворами неионных детергентов, центрифугированием и растворением образовавшегося осадка в растворе гуанидин гидрохлорида с последующей ренатурацией интерферона и его очисткой с использованием ионообменной хроматографии на ионообменных смолах типа Ватман СМ 52 целлюлоза. Изобретение позволяет повысить продуктивность получения ИНТ. 3 с. и 4 з.п.ф-лы, 1 ил. 


ОПИСАНИЕ ИЗОБРЕТЕНИЯ



Изобретение относится к биотехнологии, а именно к способам получения рекомбинантного лейкоцитарного интерферона альфа-2b человека медицинского назначения (далее ИНТ), а также к рекомбинантным штаммам Escherichia coli (E. Coli) и плазмидам для его получения.

Известны способы получения лейкоцитарного интерферона человека из лейкоцитов донорской крови человека, индуцированных вирусами, двуцепочечными РНК и другими индукторами (авт. св. и пат. СССР N 297296, 1970; N 1366064, 1983, N 1713591, 1986 - кл. C 12 N 15/00; пат. РФ NN 1364343, 1984; 1709615, 1990; 2066188, 1993 - кл. C 12 N 15/00).

Недостатками этих способов являются, как правило, низкий выход продукта, невозможность масштабирования этого процесса, вероятность контаминации конечного продукта вирусами человека, такими как вирус гепатита В и C, вируса иммунодефицита и др. Поэтому в настоящее время более перспективным признан способ получения ИНТ микробиологическим синтезом, который обеспечивает возможность получения целевого продукта со значительно более высоким выходом из сравнительно недорогого исходного сырья. Используемые при этом химические подходы позволяют создать оптимальные для бактериальной экспрессии варианты структурного гена, а также регуляторных элементов, контролирующих его экспрессию.

В настоящее время в качестве исходных микроорганизмов используют в основном различные искусственно сконструированные штаммы P. pastoris Ps. putida и Е. coli.

Недостатком штамма P. Pastoris (J.N. Garcia, J.A. Aguiar et. al.//High level expression of human IFN-2b in Pichia pastoris.//Biotecnologia Aplicada. , 12(3)., 152-155., 1995), является низкий уровень выхода целевого продукта на грамм биомассы, а штамма Ps. putida (Пат. СССР N 1640996, 1989, кл. C 12 N 15/00) - сложность выделения конечного продукта и, следовательно, трудоемкость и высокая себестоимость процесса с его участием.

Известно значительное количество плазмид и созданных на их основе штаммов Е. coli: штаммы Е. coli ATCC 31633 и 31644 с плазмидами Z- pBR322 (Pst1) HclF-11-206 или Z-pBR 322 (Pstl)/HclN SN 35-AHL6 (пат. УР N13380, 1997, C 12 N 15/21) штамм Е. coli HB 101 с плазмидой pER 103 (пат. СССР N1417800, 1985, кл. C 12 N 15/00); штамм E.coli SG 20050 с плазмидой p280/21FN (Кравченко В. В. и др. Биоорганическая химия, 1987, т. 13, N 9, с. 1186-1193) и другие.

Недостатком технологий, основанных на этих штаммах, является их нестабильность, а также недостаточный уровень экспрессии интерферона.

Прототипом заявляемых штамма и плазмиды является штамм E.coli sg 20050/ pIF16, депонированный под N ВКПМ в5809 и рекомбинантная плазмида pIF16, содержащая тандем двух синтетических генов альфа-интерферона, между которыми встроен синтетический цистрон orf 69 длиной 69 нуклеотидных остатков (пат. РФ N2054041, 1996, кл. C 12 N 15/21).

Экспрессия альфа-интерферона штаммом E.coli SG 20050 (plF16), содержащий эту плазмиду, контролируется тандемом двух мутантных конститутивных триптофановых промоторов и терминатором транскрипции фага 1. Плазмида содержит селективный маркер - ген устойчивости к ампициллину и репликон вектора pBR322. Уровень экспрессии ИНТ - 200-300 мг на л клеточной суспензии.

Недостатками данной плазмиды и штамма на ее основе являются использование в плазмиде сильных нерегулированных промоторов, что приводит к быстрой диссоциации плазмиды; а также использование гена бетта-лактомазы в качестве селективного маркера, т. к. она секретируется из бактериальной клетки и разрушает антибиотик, в результате чего в процессе ферментации происходит постоянное снижение селектирующего условия для плазмид-содержащих клеток штамма, накопление бесплазмидных клеток и в результате снижение выхода интерферона.

Наряду с особенностями используемых штаммов эффективность процесса во многом зависит от используемой технологии выделения и очистки интерферона.

Известен способ получения ИНТ, включающий в себя культивирование клеток Ps. putida, разрушении биомассы, обработку полиэтиленимином, фракционирование сернокислым аммонием, гидрофобную хроматографию нафенилсилохроме C-80, pH-фракционирование лизата, его концентрирование и диафильтрацию, ионообменную хроматографию на целлюлозе DE-52, элюирование в градиенте pH, ионообменную хроматографию полученного элюента на целлюлозе СМ-52, концентрирование пропусканием через кассету фильтров и гель- фильтрацию на Сефадексе G-100 (Авт. св. СССР N 1640996, 1995, кл. C 07 K 14/56).

Недостатком способа является его низкая продуктивность при использовании технологии на основе клеток Ps. Putida, а также многостадийность и большие потери конечного продукта.

Известен способ получения ИНТ, включающий в себя культивирование штамма E. coli SG 20050/pIF16, в LB-бульоне в колбах на качалке, центрифугирование биомассы, ее промывку буферным раствором и обработку ультразвуком для разрушения клеток. Полученный лизат центрифугируют, промывают 6M раствором мочевины в буфере PBS, содержащем хлористый натрий, калий фосфат и Na2EDTA, растворяют в растворе гуанидинхлорида в буфере PBS и центрифугируют ((пат. РФ N 2054041, 1996, кл. C 12 N 15/21).

Недостатками способа являются его относительно невысокая производительность, неустойчивость продуцента в процессе ферментации и, как следствие, нестабильность выхода интерферона.

Прототипом заявляемого способа получения ИНТ является способ получения лейкоцитарных интерферонов человека, (в частности ИНТ), заключающийся в культивировании штамма E.coli 294 ATCC 31446, трансформированного введением плазмид, замораживании полученных клеток, их разрушении механическими методами, суспендировании в буферном растворе и гомогенизировании. Для удалении ДНК и РНК к гомогенизату добавляют полиэтиленимин, после чего удаляют фильтрацией или центрифугированием твердые вещества. Верхний слой концентрируют ультрафильтрацией, а затем подвергают сначала аффинной хроматографии, регулированию pH, а затем подвергают ионообменной хроматографии на целлюлозе СМ52 или ее эквиваленте с использованием буферных растворов. (Пат. СССР N 1414319, 1981, кл. C 12 N 15/00).

Недостатком способа является его многостадийность и низкая технологичность.

Задачей, стоящей перед авторами, являлось создание более продуктивной плазмидной ДНК, штамма-продуцента и технологии получения ИНТ.

Указанная задача решалась созданием рекомбинантной плазмидной ДНК pSS5 и штамма Escherichia coli SS5.

Плазмида pSS5 имеет 3604 пар оснований (п.о.) и характеризуется наличием следующих фрагментов:

DraI-HindIII фрагмента ДНК плазмиды pUC19 размером 1103 п.о., содержащий последовательность, ответственную за репликацию плазмиды, и последовательность лактозного промотора (Plac);

HindIII-XbaI фрагмента ДНК размером 226 п.о., содержащий последовательности двух промоторов - промотор фага T7 (PT7) и триптофановый промотор (Ptrp) - и последовательность Шайн Дальгарно, ответственную за инициацию трансляции;

XbaI-BamHI фрагмента ДНК размером 512 п.о., содержащий последовательность полусинтетического гена альфа-интерферона, полученного с помощью метода амплификации ДНК (ПЦР);

BamHI-SspI фрагмента ДНК плазмиды pKK233-3 размером 529 п.о., в котором HindIII сайт AAGCTT заменен на последовательность AAGCTAGCTT, содержащий последовательность rrnBT1T2, ответственную за терминацию транскрипции,

PstI-PstI фрагмент ДНК размером 1227 п.о. плазмиды pUC4K, в котором сайт HindIII AAGCTT заменен на последовательность AAACTT методом направленного мутагенеза с помощью метода ПЦР, кодирующий устойчивость к канамицину (kan).

На чертеже - последовательность нуклеотидов плазмиды pSS5.

Штамм Escherichia coli SS5 получен трансформацией клеток Escherichia coli BL21 (DE 3) плазмидой pSS5 с использованием традиционной генно-инженерной технологии.

Штамм E.coli SS5 характеризуется следующими признаками:

Культурально-морфологические признаки.

Клетки мелкие, прямые, утолщенной палочковидной формы, грамотрицательные, неспороносные.

Клетки хорошо растут на простых питательных средах. При росте на агару "Дифко" колонии круглые, гладкие, выпуклые, мутные, блестящие, серые, края ровные. При росте в жидких средах (на минимальной среде с глюкозой или LB-бульоне) образуют интенсивную ровную муть.

Физико-биологические признаки

Аэроб. Температурный диапазон роста 4-42oC при оптимуме pH 6,5-7,5.

В качестве источника азота используют как минеральные соли в аммонийной и нитратной формах, так и органические соединения в виде аминокислот, пептона, триптона, дрожжевого экстракта и т.д.

В качестве источника углерода используют аминокислоты, глицерин, углеводы.

Устойчивость к антибиотикам. Клетки проявляют устойчивость к канамицину (до 100 мкг/мл).

Штамм Escherichia coli SS5 - продуцент альфа-интерферона

Способ, условия и состав среды для хранения штамма:

L-агар с добавлением 20 мкг/мл канамицина под маслом, L-бульон с 15% глицерином и антибиотиками при -20oC в ампулах, в лиофилизированном состоянии в ампулах при -70oC.

Штамм Escherichia coli SS5 идентифицирован по Определителю Берги (1974) как штамм вида Escherichia coli.

Особенностью заявляемого способа является разработка технологии, позволяющей выделять интерферон в виде нерастворимой формы (в виде телец включения (ТВ)), что позволяет существенно упростить технологическую схему процесса и повысить выход целевого продукта.

Способ заключается в культивировании в питательной среде штамма Escherichia coli SS5, замораживании биомассы (БМ) при температуре не выше -70oC, размораживании БМ при повышении температуры до 4oC, разрушении клеток микроорганизма обработкой их лизоцимом, удалении ДНК и РНК введением в лизат ДНК-азы и очисткой ТВ отмывкой детергентами, центрифугированием, растворением ТВ в растворе гуанидин гидрохлорида и последующей ренатурацией ИНТ, ренатурацию проводят путем разведения ИНТ буферным раствором, содержащим неионные детергенты. Полученный ИНТ подвергают очистке с помощью ионообменной хроматографии на целлюлозе СМ 52 целлюлоза.

Оптимальными условиями проведения отдельных стадий получения интерферона являются следующие:

разрушение клеток осуществляют введением лизоцима в раствор в концентрации 0,1-0,2 мас.%;

удаление ДНК и РНК проводят инкубированием суспензии интерферона с избытком ДНК-азы при комнатной температуре в течение по крайней мере 1 часа;

очищенный осадок ИНТ растворяют в 6M буферном растворе гуанидин гидрохлорида;

ренатурацию проводят путем разбавления раствора ИНТ буферным раствором, содержащим неионные детергенты.

Выход ИНТ в результате применения способа в оптимальном режиме составляет не менее 700 мг очищеннго ИНТ с 1 л культуральной среды, уровень экспрессии ИНТ - не менее 800 мг с 1 л культуральной среды.

Существенными отличиями заявляемого способа от прототипа являются использование более продуктивного нового штамма, что позволяет изменить технологический процесс и сделать более целесообразным ферментативное разрушение вместо механического и получение нерастворимой формы интерферона, использование для удаления ДНК и РНК обработку ДНК-зой, перевод ИНТ в растворимую форму и ренатурацию, замена трехстадийной очистки ИНТ на одностадийную.

Сущность и преимущества заявляемой группы изобретений иллюстрируется следующими примерами.

Пример 1. Получение рекомбинантной плазмиды.

Технология получения плазмиды pSS5 включает следующие этапы:

получение полусинтетического гена альфа-интерферона,

конструирование векторной плазмиды pSSI,

конструирование рекомбинантной плазмиды pSS5.

Получение полусинтетического гена альфа-интерферона.

Для клонирования гена альфа-интерферона был использован метод прямой полимеразной цепной реакции (ПЦР) для амплификации фрагмента ДНК из тотальной геномной ДНК человека, кодирующий альфа-интерферон (S.L. Emanuel, S. Pestka. //Human interferon-aA, -a2, and a2 (Arg) genes in genomic DNA/The J.of Biol. Chem., V. 268., No 17., 12565- 12569, 1993).

Для амплификации использовались два праймера: 1 и 2, нуклеотидная последовательность которых была составлена на основе известной первичной структуры гена альфа-2в интерферона человека.

S1-5'-CTAGTCTAGATGTGTGATCTGCCTCAAA-3' и S2-5'-CGCGGATCCTCATTCCTTACTTCTTAAACТТТC-3'.

Данную и последующие ПЦР реакции проводили в следующих условиях: 10 mM Tis-HCl, pH 8.3, 50 mM KCI, 3 mM MgCl2, 0.2 mM каждого dNTP, 1.25 ед. Taq-полимеразы, 100 нг ДНК.

Процесс амплификации состоял из следующих стадий: прогревание при 94oC 3 мин, 35 циклов ПЦР (30 с 94oC, 30 с 56oC, 30 с 72oC) и инкубация при 2 мин 72oC. Полученный фрагмент ДНК размером 539 п.о. обрабатывали рестриктазами XbaI, BamHI, клонировали в вектор pUC19 по этим же сайтам рестрикции, структуру клонированого фрагмента подтверждали определением нуклеотидной последовательности. В результате была получена плазмида pUCAl размером 3225 п. о. , в которой ДНК гена альфа-интерферона фланкирована сайтами рестрикции XbaI и BamHI.

Мутагенез гена альфа-интерферона заключался в замене редко встречающихся триплетов в Е. coli, кодирующих соответствующие аминокислоты на часто встречающиеся триплеты в Е. coli, кодирующие эти же аминокислоты. Мутагенез ДНК гена альфа-интерферона проводится методом ПЦР. Для амплификации ДНК использовали праймеры:

S3-5'-CTAGTCTAGATGTGTGATCTGCCGCAGACCCACTCCCTGGGTA GCCGTCGTACCCTGATGCTCCTGGCACAGATGCGTCGTATCTCTCTGTTCTCC-3' и

S4-5' -CGCGGATCCTCATTCCTTGGAACGCAGGGATTCCTGCAGGTT GGTGGACAGAGAAAAAGAACGCATGAТТТCTGCACGAACAACCTC-3'

В реакции ПЦР ДНК плазмиды pUCAl использовали в качестве матрицы. Полученный фрагмент ДНК размером 539 п. о. обрабатывали рестриктазами XbaI, BamHI, клонировали в вектор pUC19 по этим же сайтам рестрикции, структуру клонированного фрагмента подтверждали определением нуклеотидной последовательности. В результате была получена плазмида pUCA2 размером 3225 п.о., в которой ДНК полусинтетического гена альфа-интерферона фланкирована сайтами рестрикции XbaI и BamHI.

Конструирование векторной плазмиды pSS1.

Векторная плазмида pSS1 представляет собой вектор pUC19, в котором ген amp заменяется на ген kan, с удаленным HindIII сайтом, и по сайтам рестрикции BamHI- SspI клонирован фрагмент ДНК, содержащий терминатор транскрипции из плазмиды рKK223-3, в котором также был удален HindIII сайт.

Конструирование векторной плазмиды pSS1 проводят в четыре стадии:

- удаление сайта HindIII в плазмиде рKK223-3,

- получение плазмиды pUC19T,

- мутагенез гена kan (удаление HindIII сайта в ген kan),

- получение векторной плазмиды pSS1

ДНК плазмиды рKK223-3 обрабатывают последовательно ферментом рестрикции HindIII, ферментом фрагмент Кленова и далее ферментом лигаза фага T4.

Лигированную ДНК трансформируют в клетки штамма E.coli DH5 и высевают на среду LB, содержащую 100 мкг/мл ампициллина. После инкубирования в течение 12 час при 37oC клоны отсевают, выделяют плазмидную ДНК и проводят рестрикционный анализ. В результате была получена плазмида pKK223-3H размером 4588 п.о.

Переклонирование фрагмента ДНК BamHI-Ssp1 размером 520 п.о., кодирующего терминатор транскрипции rrn BT1T2, из плазмиды рKK223-3H в плазмиду pUC19 по этим же сайтам осуществляется обработкой этих плазмид ферментами рестрикции BamHI и Ssp1, а затем лигированием лигазой фага T4. Лигированную ДНК трансформировали в клетки штамма E.coli DH5, высевали на среду LB, содержащую 100 мкг/мл ампициллина и инкубировали 12 час при 37oC. Клоны отсевали, выделяли плазмидную ДНК и осуществляли рестрикционный анализ. В результате была получена плазмида pUC19T размером 2600 п.о. На третьей стадии проводили удаление HindIII сайта из гена kan и замещение гена amp на ген kan с удаленным HindIII сайтом в плазмиде pUC19T. Для этого проводили три раунда амплификации ДНК методом ПЦР.

В ходе первого раунда, используя ДНК плазмиды pUC4K в качестве матрицы, проводят амплификацию фрагмента ДНК размером 757 п.о., кодирующего N-конец гена kan, с помощью праймеров:

S5-5'-AGAATGGCAAAAGТТТATGCAТТТ-3'

24-mer rev Sequencing primer - 5'-AGCGGATAACAAТТТCACACAGGA-3'

В ходе второго раунда, используя ДНК плазмиды pUC4K в качестве матрицы, проводят амплификацию фрагмента ДНК размером 642 п.о., кодирующего C-конец гена kan, с помощью праймеров:

S6-5'-AAATGCATAAACТТТTGCCATTCT-3'

24-mer Sequencing primer - 5'-CGCCAGGGТТТTCCCAGTCACGA-3'

В ходе третьего раунда, используя ДНК фрагментов из предыдущих двух реакций ПЦР (раунда 1 и раунда 2) в качестве матрицы, проводят амплификацию фрагмента ДНК размером 1376 п.о., кодирующего полный ген kan с удаленным HindIII сайтом, используя праймеры:

24-mer rev Sequencing primer - 5'-AGCGGATAACAAТТТCACACAGG A-3'

24-mer Sequencing primer - 5'-CGCCAGGGТТТTCCCAGTCACGA-3'.

Далее получают векторную плазмиду pSS1. Для этого ДНК фрагмента размером 1376 п.о., полученного в 3 раунде амплификации, обрабатывают последовательно ферментом рестрикции PstI и ферментом фрагмент Кленова, а ДНК полученной плазмиды pUC19T ферментами рестрикции SspI и DraI. Далее, обработанные таким образом фрагмент ДНК, кодирующий ген kan и ДНК плазмиды pUC19T лигируют ферментом лигаза фага Т4. Лигированную ДНК трансформируют в клетки штамма E. coli DH5 и высевают на среду LB, содержащую 20 мкг/мл канамицина. После культивирования в течение 12 ч. при 37oC клоны отсевают, выделяют плазмидную ДНК, проводят рестрикционный анализ. В результате получают векторную плазмиду pSS1 размером 2920 п.о.

Конструирование рекомбинантной плазмиды pSS5

Конструирование рекомбинантной плазмиды pSS5 проводят в две стадии:

конструирование фрагмента ДНК фланкирующего сайтами рестрикции HindIII- XbaI, кодирующего одновременно промотор фага T7, промотор триптофанового оперона и SD последовательность (Шайн-Дельгарно);

конструирование рекомбинантной плазмиды pSS5.

Первая стадия осуществляется путем амплификации фрагмента ДНК размером 230 п. о. с помощью реакции ПЦР, в которой используются в качестве матрицы ДНК Е. coli и следующие праймеры:

S7 (в котором имеются последовательность сайта рестрикции для фермента Hindlll, последовательность, кодирующая T7 промотор, и последовательность, кодирующая

5'-конец триптофонового промотора):

5'-CCCAAGCTtaatacgactcactatagggagacccTATGGCTGTGCAGGTCGTA и

S8 (в котором имеются последовательность сайта рестрикции для фермента XbaI, SD последовательность и последовательность, кодирующая 3'-конец триптофанового промотора):

5'-TGCTCTAGATTATCTCCTTGAATTCCТТТTTACGTGAACTTGCGTA-3'.

На второй стадии амплифицированный фрагмент ДНК с праймеров S7-S8 обрабатывали ферментами рестрикции HindIII-XbaI, ДНК плазмиды pUCA обрабатывали ферментами рестрикции XbaI-BamHI, а ДНК плазмиды pSSI обрабатывали ферментами рестрикции HindIII- BamHI и далее полученные фрагменты ДНК лигировали.

Лигированную ДНК трансформировали в клетки штамма E.coli DH5, высевали на среду LB, содержащую 20 мкг/мл канамицина и инкубировали 12 ч при 37oC. Клоны отсевали, выделяли плазмидную ДНК, проводили рестрикционный анализ и определяли нуклеотидную последовательность.

В результате была получена рекомбинантная плазмида pSS5 размером 3604 п. о.

Пример 2. Получение штамма Е.coli SS5 - продуцента интерферона

Штамм-продуцент альфа-интерферона Е. coli SS5 получали путем трансформации клеток штамма Е. coli BL21 рекомбинантной плазмидой pSS5 с последующим отбором рекомбинантных клонов на среде с канамицином при 37oC и с определением активности альфа-интерферона и определением количества альфа-интерферона в экстрактах клеток, выращенных до оптической плотности 15.0-16.0 о. е. в среде M9, содержащей 1% кислотного гидролизата казеина (Difco), 1% глюкозы, 20 мкг/мл канамицина, при температуре 38-39oC.

Активность альфа-интерферона определяли методом ингибирования цитопатического действия вируса везикулярного стоматита на диплоидные фибробласты человека и иммуноферментным методом.

Содержание альфа-интерферона в 15-20 г биомассы клеток, получаемых с 1 л культуры, составляло в зависимости от серии 700- 800 мг альфа-интерферона с суммарной активностью 1-2 х 10 ME.

Пример 3. Получение ИНТ из штамма Е. соli SS5.

Получение альфа-интерферона проводили в 4 этапа:

1 этап. Культивирование штамма Е. coli SS5

2 этап. Выделение и очистка нерастворимой формы альфа-интерферона

3 этап. Растворение и ренатурация альфа-интерферона

4 этап. Хроматографическая очистка альфа-интерферона

Культивирование штамма К. coli SS5.

Выращенный посевной материал штамма Е. coli SS5 в 750 мл богатой среды LB в течение 12 ч при 26oC асептически вносили в лабораторный ферментер, содержащий 8.0 л стерильной среды, содержащей 1 х M9, 1% кислотного гидролизата казеина, 1% глюкозы, 1 мМ MgCl2, 0.1 mM CaCl2, 20 мг/мл канамицина. Выращивание в ферментере проводили при температуре 38-39oC, поддерживая pH 70,15 путем автоматической подтитровки 40%-ным раствором гидроокиси натрия. Концентрацию растворенного кислорода в диапазоне (4010)% от насыщения поддерживали путем изменения скорости оборотов мешалки от 100 до 400 об/мин и подачи воздуха от 0.2 до 1.5 объема воздуха/мин.

Накопление альфа-интерферона в виде нерастворимой формы - "телец включений" контролировали с помощью фазово-контрастной микроскопии. Ферментацию заканчивали по достижении максимальной оптической плотности (15-16) о.е. и появлению зрелых "телец включений". По окончании культивирования биомассу отделяли от среды центрифугированием при скорости вращения 5000-10000 об/мин. Биомассу фасовали в полиэтиленовые пакеты и замораживали при температуре минус 70oC.

Выделение и очистка нерастворимой формы альфа-интерферона.

20 г замороженной биомассы штамма Е. coli SS5 суспендировали в 200 мл буфера 1 (10 мМ Tris-HCl, pH 8.0, 10 мМ ЭДТА, 0.1% Triton Х100), добавляли 30 мг лизоцима и инкубировали с перемешиванием при температуре 4oC в течение 30 мин. Обработанную лизоцимом суспензию замораживали при минус 20oC в течение 3 час, а затем повышали температуру до комнатной. К суспензии добавляли 5 мг ДНКазы и 5 мМ MgCl2, инкубировали в течение 1 час при комнатной температуре, а затем добавляли равный объем буфера 2 (10 мМ Tris- HCl pH 8.0, 1 мМ ЭДТА, 0.1% Triton Х100), интенсивно перемешивали и центрифугировали 20 мин на центрифуге Бэкман J2-21 при скорости 9000 об/мин на роторе JA-10. Полученный осадок промывали последовательно еще один раз буфером 2, буфером 3 (10 мМ Tris-HCl pH 8.0, 1 мМ ЭДТА, неионный детергент). При этом время инкубации в этом буфере составляло не менее 12 час при 4oC. Дальнейшую промывку вели буфером 2 с 3 М мочевиной, буфером 2 без детергента Triton X100, раствором 40% изопропанола и в заключение - водой.

Растворение и ренатурация альфа-интерферона

Полученный на предыдущем этапе осадок растворяли в 5-10 мл раствора 6 М гуанидин гидрохлорида, содержащего 100 мМ ДТТ, 20 мМ Tris-HCl и выдерживали при pH 8.0 и комнатной температуре в течение 2 ч. Нерастворившийся материал удаляли центрифугированием при 18 000 об/мин на центрифуге Бэкман J2-21 в роторе JA-10.

Ренатурацию альфа-интерферона проводили путем медленного разбавления полученного раствора в 250-500 мл буфера 4 (20 мМ Tris-HCl pH 8.0, 70 мМ NaCl, смесь неионных детергентов) при температуре 4oC. После чего инкубировали раствор с постоянным перемешиванием в течение 24 час. Далее агрегированный материал удаляли центрифугированием при 9 000 об/мин в роторе JA-10 на центрифуге Бэкман J2-21.

Хроматографическая очистка альфа-интерферона.

Хроматографическую очистку альфа-интерферона проводили на катионите CM-52 (Watm). К раствору ренатурированного альфа-интерферона добавляли 1M раствор NH4(CH3COO) при pH 4.5 до концентрации 25 мМ и наносили на смолу CM-52, предварительно уравновешенную буфером 5 (25 мМ NH4(CH3COO), pH 4.5). Далее смолу промывали буфером 6 (50 мМ NH4(CH3COO) при pH 4.5), буфером 7 (50 мМ NH4(CH3COO) при pH 5.0).

ИНТ элюировали буфером 7, содержащим 0,15 мМ NaCl. Выход интерферона альфа-2b составлял не менее 800 мг из 20 г биомассы, полученной с 1 л культуральной среды с удельной активностью не менее 2108 МЕ/мг.

Как следует из приведенных примеров, заявляемая группа изобретений позволяет получать интерферон альфа-2b с высоким выходом при относительно простой и надежной технологии. 


ФОРМУЛА ИЗОБРЕТЕНИЯ



1. Рекомбинантная плазмидная ДНК pSS5, кодирующая синтез рекомбинантного альфа 2b интерферона человека, размером 3604 п.о., содержащая: Dral-HindШ фрагмент ДНК плазмиды pUC19 размером 1103 п.о., HindШ-Xbal фрагмент ДНК размером 226 п.о., включающий последовательности двух промоторов - промотор фага Т7 и триптофановый промотор и последовательность Шайн Дальгарно; Xbal-BamHl фрагмент ДНК размером 512 п.о., включающий последовательность полусинтетического гена альфа-2b интерферона человека, полученного с помощью метода амплификации ДНК; BamHl-Sshl фрагмент ДНК плазмиды рКК 233-3 размером 529 п. о. , содержащий последовательность AAGCTAGCTT, и последовательность rrnBT1T2; Pstl-Pstl фрагмент ДНК размером 1227 п.о плазмиды pUC4K, содержащий последовательность AAACTT, и имеющая нуклеотидную последовательность, приведенную на фиг.1.

2. Штамм бактерий Escherichia coli SS5 - трансформированный рекомбинантной плазмидой по п.1 - продуцент рекомбинантного лейкоцитарного альфа-2b интерферона человека.

3. Способ получения интерферона альфа-2b человека с использованием трансформированного методами генетической инженерии штамма Escherichia coli, включающий в себя его культивирование в питательной среде, замораживание биомассы штамма при температуре не выше - 70oC, ее размораживание при повышении температуры до 4oC, разрушение клеток микроорганизма, удаление ДНК и РНК, концентрирование полученного продукта и его очистку с использованием ионообменной хроматографии на целлюлозе СМ 52, отличающийся тем, что культивируют штамм Escherichia coli SS5 по п.2, разрушение клеток осуществляют с помощью лизоцима, удаление ДНК и РНК проводят обработкой ДНК-азой, очистку нерастворимой формы интерферона осуществляют обработкой растворами неионных детергентов с последующим центрифугированием, растворением образовавшегося осадка в растворе гуанидин гидрохлорида с последующей ренатурацией интерферона, после чего его подвергают непосредственно ионообменной хроматографии.

4. Способ по п.3, отличающийся тем, что разрушение клеток осуществляют введением лизоцима в раствор в концентрации 0,1-0,2 мас.%.

5. Способ по п.3, отличающийся тем, что удаление ДНК и РНК проводят инкубированием суспензии интерферона с избытком ДНК-азы при комнатной температуре в течение по крайней мере 1 ч.

6. Способ по п. 3, отличающийся тем, что при концентрировании образовавшийся осадок растворяют в 6М буферном растворе гуанидин гидрохлорида.

7. Способ по п.3, отличающийся тем, что ренатурацию проводят путем растворения осадка в буферном растворе, содержащем неионные детергенты.